Incidental Mutation 'R3936:Il22ra2'
ID307175
Institutional Source Beutler Lab
Gene Symbol Il22ra2
Ensembl Gene ENSMUSG00000039760
Gene Nameinterleukin 22 receptor, alpha 2
SynonymsIl-22bp
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3936 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location19621998-19634681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19631708 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 156 (S156R)
Ref Sequence ENSEMBL: ENSMUSP00000042642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036564]
Predicted Effect probably benign
Transcript: ENSMUST00000036564
AA Change: S156R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000042642
Gene: ENSMUSG00000039760
AA Change: S156R

DomainStartEndE-ValueType
Pfam:Tissue_fac 6 113 3.4e-37 PFAM
Pfam:Interfer-bind 125 230 1.4e-26 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the class II cytokine receptor family. The encoded soluble protein specifically binds to and inhibits interleukin 22 activity by blocking the interaction of interleukin 22 with its cell surface receptor. The encoded protein may be important in the regulation of inflammatory response, and has been implicated in the regulation of tumorigenesis in the colon. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation display accelerated tumor formation in a colitis associated colon cancer model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 C T 12: 53,140,444 T1547M possibly damaging Het
Alk T A 17: 72,205,954 I337F probably damaging Het
Ank3 A T 10: 69,879,989 K491* probably null Het
Arx T A X: 93,297,369 L554Q probably damaging Het
Axdnd1 T C 1: 156,331,639 N203S probably benign Het
Baz2b A G 2: 59,912,761 V1622A possibly damaging Het
Btnl6 T A 17: 34,517,342 H4L probably benign Het
Dync2h1 C A 9: 7,001,482 L3835F probably damaging Het
Fcgbp T C 7: 28,075,399 F133L probably benign Het
Fnip1 A G 11: 54,480,239 probably null Het
G6pc A G 11: 101,374,603 I154V probably benign Het
Golgb1 G T 16: 36,914,056 E1222* probably null Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Gzmk A T 13: 113,173,025 S164T probably damaging Het
Kansl1 A T 11: 104,343,543 D712E possibly damaging Het
Mc3r T A 2: 172,249,296 I146N probably damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mitf C T 6: 97,993,253 P54S probably damaging Het
Olfr156 T A 4: 43,821,359 M1L probably benign Het
P4hb A C 11: 120,562,409 H440Q probably benign Het
Pbsn T C X: 77,848,096 T32A probably damaging Het
Rptn A C 3: 93,395,576 H72P possibly damaging Het
Scn1a T C 2: 66,327,776 I418V probably damaging Het
Sf3a1 T A 11: 4,180,024 probably null Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slc9c1 A G 16: 45,606,830 probably benign Het
Sorcs3 T A 19: 48,713,504 V608D probably damaging Het
Sult2b1 C T 7: 45,742,216 V49M probably benign Het
Tlr11 A G 14: 50,362,735 E726G possibly damaging Het
Treh C T 9: 44,684,543 R342W probably benign Het
Other mutations in Il22ra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02572:Il22ra2 APN 10 19626744 missense probably benign 0.04
IGL02835:Il22ra2 UTSW 10 19626676 missense probably benign 0.04
R0009:Il22ra2 UTSW 10 19624458 missense probably damaging 1.00
R0009:Il22ra2 UTSW 10 19624458 missense probably damaging 1.00
R1687:Il22ra2 UTSW 10 19632872 missense probably benign 0.09
R1802:Il22ra2 UTSW 10 19626699 missense probably damaging 0.98
R2138:Il22ra2 UTSW 10 19632870 missense probably benign 0.00
R2139:Il22ra2 UTSW 10 19632870 missense probably benign 0.00
R4063:Il22ra2 UTSW 10 19626652 missense possibly damaging 0.88
R4559:Il22ra2 UTSW 10 19626712 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CAGTGATTTATGGAGAAGCACAGTG -3'
(R):5'- CAGGCACTTGCTTATCAGTGAAG -3'

Sequencing Primer
(F):5'- GGAGAAGCACAGTGTCTATTTATAG -3'
(R):5'- CACTTGCTTATCAGTGAAGATGTAAG -3'
Posted On2015-04-17