Incidental Mutation 'R3936:G6pc'
ID307180
Institutional Source Beutler Lab
Gene Symbol G6pc
Ensembl Gene ENSMUSG00000078650
Gene Nameglucose-6-phosphatase, catalytic
SynonymsGlc-6-Pase, G6Pase, G6pt, Glc-6-Pase-alpha
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3936 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101367561-101377903 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101374603 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 154 (I154V)
Ref Sequence ENSEMBL: ENSMUSP00000019469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019469]
Predicted Effect probably benign
Transcript: ENSMUST00000019469
AA Change: I154V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000019469
Gene: ENSMUSG00000078650
AA Change: I154V

DomainStartEndE-ValueType
acidPPc 56 196 2.28e-40 SMART
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 256 278 N/A INTRINSIC
transmembrane domain 291 308 N/A INTRINSIC
transmembrane domain 323 345 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: The enzyme encoded by this gene is a multisubunit integral membrane protein of the endoplasmic reticulum that is composed of a catalytic subunit and transporters for glucose-6-phosphate, inorganic phosphate, and glucose. This gene is one of three glucose-6-phosphatase catalytic-subunit-encoding genes in mouse. Glucose-6-phosphatase catalyzes the hydrolysis of D-glucose 6-phosphate to D-glucose and orthophosphate and is a key enzyme in glucose homeostasis, functioning in gluconeogenesis and glycogenolysis. Mutations in this gene cause glycogen storage disease type I (GSD1). [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene tend to die within a couple of weeks of weaning. Blood chemistry and glucose metabolism are abnormal as is glycogen storage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 C T 12: 53,140,444 T1547M possibly damaging Het
Alk T A 17: 72,205,954 I337F probably damaging Het
Ank3 A T 10: 69,879,989 K491* probably null Het
Arx T A X: 93,297,369 L554Q probably damaging Het
Axdnd1 T C 1: 156,331,639 N203S probably benign Het
Baz2b A G 2: 59,912,761 V1622A possibly damaging Het
Btnl6 T A 17: 34,517,342 H4L probably benign Het
Dync2h1 C A 9: 7,001,482 L3835F probably damaging Het
Fcgbp T C 7: 28,075,399 F133L probably benign Het
Fnip1 A G 11: 54,480,239 probably null Het
Golgb1 G T 16: 36,914,056 E1222* probably null Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Gzmk A T 13: 113,173,025 S164T probably damaging Het
Il22ra2 T A 10: 19,631,708 S156R probably benign Het
Kansl1 A T 11: 104,343,543 D712E possibly damaging Het
Mc3r T A 2: 172,249,296 I146N probably damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mitf C T 6: 97,993,253 P54S probably damaging Het
Olfr156 T A 4: 43,821,359 M1L probably benign Het
P4hb A C 11: 120,562,409 H440Q probably benign Het
Pbsn T C X: 77,848,096 T32A probably damaging Het
Rptn A C 3: 93,395,576 H72P possibly damaging Het
Scn1a T C 2: 66,327,776 I418V probably damaging Het
Sf3a1 T A 11: 4,180,024 probably null Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slc9c1 A G 16: 45,606,830 probably benign Het
Sorcs3 T A 19: 48,713,504 V608D probably damaging Het
Sult2b1 C T 7: 45,742,216 V49M probably benign Het
Tlr11 A G 14: 50,362,735 E726G possibly damaging Het
Treh C T 9: 44,684,543 R342W probably benign Het
Other mutations in G6pc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:G6pc APN 11 101370723 missense probably damaging 1.00
IGL03068:G6pc APN 11 101370750 missense probably benign 0.01
R1988:G6pc UTSW 11 101367942 missense probably damaging 0.97
R4601:G6pc UTSW 11 101372741 missense probably damaging 1.00
R4677:G6pc UTSW 11 101376613 missense probably benign
R6073:G6pc UTSW 11 101367976 missense probably benign
R6304:G6pc UTSW 11 101367909 missense probably damaging 1.00
R7103:G6pc UTSW 11 101374587 splice site probably null
R7143:G6pc UTSW 11 101370723 missense probably damaging 1.00
R7438:G6pc UTSW 11 101376677 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ACACACAGTCTTTAAGATCTCAAAAT -3'
(R):5'- CCTCTGGCCTTTGATGCTGA -3'

Sequencing Primer
(F):5'- GCTGGGGGATTTCATTCAAAAC -3'
(R):5'- GGCCTTTGATGCTGAAACTAC -3'
Posted On2015-04-17