Incidental Mutation 'R3937:Fam227b'
ID307206
Institutional Source Beutler Lab
Gene Symbol Fam227b
Ensembl Gene ENSMUSG00000027209
Gene Namefamily with sequence similarity 227, member B
Synonyms4930525F21Rik
MMRRC Submission 040921-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R3937 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location125983483-126152004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126127060 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 31 (D31E)
Ref Sequence ENSEMBL: ENSMUSP00000136349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110446] [ENSMUST00000110448] [ENSMUST00000178118]
Predicted Effect probably benign
Transcript: ENSMUST00000110446
AA Change: D31E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000106076
Gene: ENSMUSG00000027209
AA Change: D31E

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 7.6e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110448
AA Change: D31E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000106078
Gene: ENSMUSG00000027209
AA Change: D31E

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 3.8e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156413
Predicted Effect probably benign
Transcript: ENSMUST00000178118
AA Change: D31E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000136349
Gene: ENSMUSG00000027209
AA Change: D31E

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 140 293 7.2e-50 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Meta Mutation Damage Score 0.1276 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (60/60)
MGI Phenotype Mice homozygous for a knock-out allele exhibit abnormal coat appearance, abnormal kidney morphology, spleen hypoplasia, decreased vesicles clustering in GABAergic synapses, decreased miniature inhibitory postsynaptic currents, and increased susceptibility to drug-induced seizures.,NO_PHENOTYPE
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T G 4: 147,942,053 S343R possibly damaging Het
Abca8b G T 11: 109,974,567 P355T probably benign Het
Abhd15 T C 11: 77,515,938 V247A probably benign Het
Adamts1 C T 16: 85,795,619 V634M possibly damaging Het
BC049715 T C 6: 136,840,455 I231T possibly damaging Het
Chpf A T 1: 75,477,540 V198E probably damaging Het
Cp C T 3: 19,971,034 P386S probably damaging Het
Cth A G 3: 157,920,040 I107T possibly damaging Het
Ctrc T C 4: 141,840,321 D157G probably damaging Het
D630003M21Rik A G 2: 158,200,360 Y889H probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Esyt3 A T 9: 99,336,192 I130K probably benign Het
F13a1 A T 13: 36,916,901 V423D probably damaging Het
Faf1 T C 4: 109,757,692 probably benign Het
Fastkd2 A G 1: 63,737,836 D377G possibly damaging Het
Fbxl6 G A 15: 76,536,624 R384* probably null Het
Fcamr A T 1: 130,804,576 H44L probably damaging Het
Fhod3 A G 18: 25,090,761 N1055D probably benign Het
Garem1 A T 18: 21,148,806 Y164* probably null Het
Gemin4 C T 11: 76,212,888 C349Y probably damaging Het
Gnal A G 18: 67,135,370 probably null Het
Hacl1 T C 14: 31,634,191 probably benign Het
Hectd3 T C 4: 116,998,530 V409A probably benign Het
Hps6 A G 19: 46,004,053 E143G probably damaging Het
Hspa4 T A 11: 53,270,949 I459L probably benign Het
Ighv3-6 G A 12: 114,288,441 Q21* probably null Het
Ints3 G A 3: 90,403,987 R438* probably null Het
Jmjd6 T C 11: 116,841,165 N237D probably benign Het
Lrrk2 C A 15: 91,778,504 T1912K probably damaging Het
Mdga2 C A 12: 67,221,206 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh6 T C 14: 54,963,055 D203G probably benign Het
Myo5b T C 18: 74,716,037 S1116P probably damaging Het
Nalcn T A 14: 123,369,945 D704V probably benign Het
Nes A T 3: 87,971,236 M12L probably benign Het
Olfr1052 T A 2: 86,298,016 S67T probably damaging Het
Olfr118 A G 17: 37,672,967 T315A probably benign Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Olfr453 T A 6: 42,744,076 I13N probably damaging Het
Pcdha2 T C 18: 36,941,323 V669A probably benign Het
Pdhx T C 2: 103,022,219 N433S probably damaging Het
Pip5kl1 A G 2: 32,579,112 R261G probably damaging Het
Plekhj1 A G 10: 80,797,775 I76T probably damaging Het
Ppp1r3a A T 6: 14,719,074 S614T probably damaging Het
Ptpru T C 4: 131,774,304 N1207S probably damaging Het
Ranbp2 T C 10: 58,476,472 F1005L probably benign Het
Rims2 A G 15: 39,437,845 E324G probably damaging Het
Sema6d A T 2: 124,656,850 I227L probably benign Het
Smarcad1 T G 6: 65,114,336 L1014V probably damaging Het
Spag9 T C 11: 94,044,417 V18A possibly damaging Het
Spag9 T G 11: 94,044,479 S39A possibly damaging Het
Sun2 T C 15: 79,734,155 K268E probably benign Het
Tbpl2 C T 2: 24,087,139 R289Q probably benign Het
Tcea3 T A 4: 136,255,143 probably benign Het
Tmem185a C T X: 70,462,186 probably null Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Vmn1r212 A T 13: 22,883,188 V325E unknown Het
Vmn1r35 T A 6: 66,679,073 R204S probably damaging Het
Vmn2r57 A G 7: 41,428,130 M204T probably damaging Het
Wdfy3 A T 5: 101,944,239 Y411* probably null Het
Zfp335 G T 2: 164,910,700 D41E probably damaging Het
Other mutations in Fam227b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Fam227b APN 2 126144325 critical splice acceptor site probably null
IGL00970:Fam227b APN 2 126127060 missense probably benign 0.01
IGL02040:Fam227b APN 2 126121084 splice site probably benign
IGL02095:Fam227b APN 2 126101004 missense probably damaging 0.97
IGL02352:Fam227b APN 2 126146254 unclassified probably benign
IGL02359:Fam227b APN 2 126146254 unclassified probably benign
IGL02506:Fam227b APN 2 126003911 missense probably benign 0.22
IGL02717:Fam227b APN 2 126003843 missense probably null 0.97
IGL02933:Fam227b APN 2 126123988 splice site probably null
IGL03064:Fam227b APN 2 126126842 splice site probably null
IGL03086:Fam227b APN 2 126119031 missense probably benign 0.01
IGL03198:Fam227b APN 2 126124579 critical splice donor site probably null
IGL03256:Fam227b APN 2 125989003 missense probably damaging 0.99
IGL03368:Fam227b APN 2 126119063 missense probably damaging 1.00
dana UTSW 2 126116123 missense probably damaging 1.00
R0071:Fam227b UTSW 2 126124074 missense probably benign 0.04
R0071:Fam227b UTSW 2 126124074 missense probably benign 0.04
R0110:Fam227b UTSW 2 126100921 missense probably damaging 1.00
R0140:Fam227b UTSW 2 126124603 missense possibly damaging 0.53
R0377:Fam227b UTSW 2 126125000 splice site probably benign
R0499:Fam227b UTSW 2 126100909 missense probably benign 0.25
R1240:Fam227b UTSW 2 126124585 missense possibly damaging 0.56
R1356:Fam227b UTSW 2 126119008 missense probably damaging 1.00
R1404:Fam227b UTSW 2 126003839 missense probably damaging 0.99
R1404:Fam227b UTSW 2 126003839 missense probably damaging 0.99
R2055:Fam227b UTSW 2 126100954 missense probably benign 0.13
R2884:Fam227b UTSW 2 126100926 missense probably benign 0.01
R3124:Fam227b UTSW 2 126124086 missense probably benign 0.36
R3125:Fam227b UTSW 2 126124086 missense probably benign 0.36
R4408:Fam227b UTSW 2 126116125 missense possibly damaging 0.47
R4454:Fam227b UTSW 2 126146268 unclassified probably benign
R4455:Fam227b UTSW 2 126146268 unclassified probably benign
R4457:Fam227b UTSW 2 126146268 unclassified probably benign
R4558:Fam227b UTSW 2 126127043 missense probably benign 0.00
R4661:Fam227b UTSW 2 126007310 missense probably damaging 0.99
R4809:Fam227b UTSW 2 126116125 missense possibly damaging 0.47
R4810:Fam227b UTSW 2 125987939 missense probably benign 0.01
R4989:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5011:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5013:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5014:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5133:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5184:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5431:Fam227b UTSW 2 126126931 missense probably benign 0.09
R5797:Fam227b UTSW 2 126007334 missense probably benign
R6056:Fam227b UTSW 2 126121052 missense probably damaging 1.00
R6218:Fam227b UTSW 2 126126962 missense probably damaging 1.00
R6471:Fam227b UTSW 2 126121065 missense probably damaging 1.00
R6660:Fam227b UTSW 2 126144307 missense probably damaging 1.00
R6734:Fam227b UTSW 2 126126976 nonsense probably null
R7136:Fam227b UTSW 2 126124028 missense probably damaging 0.99
R7410:Fam227b UTSW 2 126119063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATAATCTGGAGGCATGGTGTTG -3'
(R):5'- AGCTGTTTTATAGGAGAATGCTTTC -3'

Sequencing Primer
(F):5'- GTTGCAAAAGATGTGAGCTTTCC -3'
(R):5'- GGAGAATGCTTTCAGTTTTTCACAG -3'
Posted On2015-04-17