Incidental Mutation 'R3938:Sytl1'
ID307263
Institutional Source Beutler Lab
Gene Symbol Sytl1
Ensembl Gene ENSMUSG00000028860
Gene Namesynaptotagmin-like 1
SynonymsPSGL-1, Slp1
MMRRC Submission 040825-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3938 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location133253090-133263113 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 133255624 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 359 (Q359*)
Ref Sequence ENSEMBL: ENSMUSP00000101528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030674] [ENSMUST00000030677] [ENSMUST00000105908]
Predicted Effect probably null
Transcript: ENSMUST00000030674
AA Change: Q424*
SMART Domains Protein: ENSMUSP00000030674
Gene: ENSMUSG00000028860
AA Change: Q424*

DomainStartEndE-ValueType
PDB:3BC1|F 40 92 2e-9 PDB
low complexity region 169 183 N/A INTRINSIC
low complexity region 235 262 N/A INTRINSIC
C2 288 389 2.36e-17 SMART
C2 429 532 6.96e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030677
SMART Domains Protein: ENSMUSP00000030677
Gene: ENSMUSG00000028862

DomainStartEndE-ValueType
low complexity region 98 109 N/A INTRINSIC
Pfam:DUF4071 130 508 2.3e-150 PFAM
S_TKc 649 907 3.49e-87 SMART
low complexity region 925 940 N/A INTRINSIC
low complexity region 947 960 N/A INTRINSIC
low complexity region 975 990 N/A INTRINSIC
low complexity region 1130 1146 N/A INTRINSIC
coiled coil region 1164 1195 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105908
AA Change: Q359*
SMART Domains Protein: ENSMUSP00000101528
Gene: ENSMUSG00000028860
AA Change: Q359*

DomainStartEndE-ValueType
PDB:3BC1|F 40 92 2e-9 PDB
low complexity region 157 171 N/A INTRINSIC
low complexity region 223 250 N/A INTRINSIC
C2 276 359 3.15e-4 SMART
C2 364 467 6.96e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154911
Meta Mutation Damage Score 0.6252 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (57/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit increased number of acinar zygomen granules in a fasted state that can be released by strong stimuli of the fed state. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,154,294 P1561L probably damaging Het
Adamts1 C T 16: 85,795,619 V634M possibly damaging Het
Arid4b A T 13: 14,186,928 N659I probably benign Het
BC049715 T C 6: 136,840,455 I231T possibly damaging Het
Bmp4 T C 14: 46,384,079 Y336C probably damaging Het
Ccdc30 G A 4: 119,352,673 T293I probably benign Het
Chd5 A T 4: 152,377,055 T1275S probably benign Het
Chtf8 A T 8: 106,885,905 M134K probably benign Het
Col11a2 A T 17: 34,039,625 probably benign Het
Cyp8b1 A G 9: 121,915,618 V216A probably benign Het
Dnah8 C T 17: 30,854,937 T4527M probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Erap1 T A 13: 74,668,028 L92Q probably damaging Het
Exoc3l G T 8: 105,293,405 P296H probably damaging Het
Gm5294 A T 5: 138,820,968 N78Y probably damaging Het
Hacl1 T C 14: 31,634,191 probably benign Het
Hrnr T A 3: 93,322,855 N133K probably benign Het
Itgax G T 7: 128,136,273 R504S possibly damaging Het
Itgb4 A G 11: 116,005,926 S1461G possibly damaging Het
Klkb1 G T 8: 45,282,801 T175K probably damaging Het
Lrrk2 A T 15: 91,712,780 D525V possibly damaging Het
Lrrk2 C A 15: 91,778,504 T1912K probably damaging Het
Mdga1 G T 17: 29,857,622 Q59K probably damaging Het
Mpp4 A G 1: 59,124,683 V466A possibly damaging Het
Myh6 T C 14: 54,963,055 D203G probably benign Het
Myo5b T C 18: 74,716,037 S1116P probably damaging Het
Nemp1 T C 10: 127,695,473 L311P probably damaging Het
Nup205 A G 6: 35,219,742 R1138G probably damaging Het
Nup54 A G 5: 92,417,529 M443T probably damaging Het
Peak1 T C 9: 56,260,365 E93G probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plekhj1 A G 10: 80,797,775 I76T probably damaging Het
Poll A G 19: 45,558,418 probably benign Het
Ppp1r3a A T 6: 14,719,074 S614T probably damaging Het
Pygm A T 19: 6,392,950 I556F probably benign Het
Ranbp2 T C 10: 58,476,472 F1005L probably benign Het
Rcor3 G T 1: 192,101,085 T361K possibly damaging Het
Robo4 A G 9: 37,402,017 probably benign Het
Rps15 T C 10: 80,293,839 V96A probably benign Het
Rrm2 T A 12: 24,709,432 N55K probably damaging Het
Shank2 T C 7: 144,128,375 Y382H probably benign Het
Slc25a10 G T 11: 120,491,993 E3* probably null Het
Slc7a8 T A 14: 54,735,841 E223V probably benign Het
Snx13 A G 12: 35,144,097 K880E probably benign Het
Spinkl T G 18: 44,168,149 M41L probably benign Het
Srp54a A C 12: 55,089,257 N19T probably benign Het
Sun2 T C 15: 79,734,155 K268E probably benign Het
Tlr6 A T 5: 64,953,595 F656L probably damaging Het
Tmem185a C T X: 70,462,186 probably null Het
Tmem45a2 C T 16: 57,039,035 D278N probably benign Het
Trav7-1 T C 14: 52,655,334 probably benign Het
Trpc2 T A 7: 102,093,574 M597K probably damaging Het
Ttc21a A G 9: 119,950,816 probably benign Het
Usp9y C T Y: 1,313,741 M2188I probably damaging Het
Utrn C A 10: 12,750,030 probably null Het
Vmn1r35 T A 6: 66,679,073 R204S probably damaging Het
Zfp955b T A 17: 33,305,416 Y59F probably damaging Het
Other mutations in Sytl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01899:Sytl1 APN 4 133258856 splice site probably null
IGL02693:Sytl1 APN 4 133257746 missense probably benign 0.03
IGL02721:Sytl1 APN 4 133258878 missense probably benign 0.25
IGL02975:Sytl1 APN 4 133261032 missense probably benign 0.05
FR4304:Sytl1 UTSW 4 133256993 small deletion probably benign
R0242:Sytl1 UTSW 4 133253457 missense probably damaging 1.00
R0242:Sytl1 UTSW 4 133253457 missense probably damaging 1.00
R0677:Sytl1 UTSW 4 133253225 missense possibly damaging 0.89
R1135:Sytl1 UTSW 4 133256970 missense probably damaging 1.00
R1269:Sytl1 UTSW 4 133256115 missense probably damaging 1.00
R2018:Sytl1 UTSW 4 133256160 missense probably damaging 0.99
R2106:Sytl1 UTSW 4 133257463 missense probably benign 0.00
R4210:Sytl1 UTSW 4 133253565 missense probably damaging 1.00
R4970:Sytl1 UTSW 4 133255582 nonsense probably null
R5027:Sytl1 UTSW 4 133256219 intron probably benign
R5325:Sytl1 UTSW 4 133261071 start gained probably benign
R5557:Sytl1 UTSW 4 133259356 missense probably damaging 1.00
R6310:Sytl1 UTSW 4 133260998 missense probably benign 0.34
T0722:Sytl1 UTSW 4 133256851 splice site probably benign
T0722:Sytl1 UTSW 4 133256853 splice site probably benign
T0975:Sytl1 UTSW 4 133256994 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CCCTGCTGATCTTGGCTGG -3'
(R):5'- GTAGAGGCCCTGTCCCCAAC -3'

Sequencing Primer
(F):5'- GGGGGACAGGTGGGTCAG -3'
(R):5'- ACCCTTCTCACACATAATCCTG -3'
Posted On2015-04-17