Incidental Mutation 'R3938:Ppp1r3a'
ID307268
Institutional Source Beutler Lab
Gene Symbol Ppp1r3a
Ensembl Gene ENSMUSG00000042717
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 3A
SynonymsRGL, GM
MMRRC Submission 040825-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3938 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location14713977-14755274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14719074 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 614 (S614T)
Ref Sequence ENSEMBL: ENSMUSP00000049054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045096]
Predicted Effect probably damaging
Transcript: ENSMUST00000045096
AA Change: S614T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049054
Gene: ENSMUSG00000042717
AA Change: S614T

DomainStartEndE-ValueType
low complexity region 37 51 N/A INTRINSIC
Pfam:CBM_21 124 231 2.3e-32 PFAM
low complexity region 370 381 N/A INTRINSIC
low complexity region 636 646 N/A INTRINSIC
low complexity region 952 961 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycogen-associated form of protein phosphatase-1 (PP1) derived from skeletal muscle is a heterodimer composed of a 37-kD catalytic subunit and a 124-kD targeting and regulatory subunit. This gene encodes the regulatory subunit which binds to muscle glycogen with high affinity, thereby enhancing dephosphorylation of glycogen-bound substrates for PP1 such as glycogen synthase and glycogen phosphorylase kinase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have reduced levels of skeletal muscle glycogen. Whereas one model was normoglycemic and grossly normal, another on a similar genetic background was glucose intolerant, insulin resistant, and gained weight to the point of obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,154,294 P1561L probably damaging Het
Adamts1 C T 16: 85,795,619 V634M possibly damaging Het
Arid4b A T 13: 14,186,928 N659I probably benign Het
BC049715 T C 6: 136,840,455 I231T possibly damaging Het
Bmp4 T C 14: 46,384,079 Y336C probably damaging Het
Ccdc30 G A 4: 119,352,673 T293I probably benign Het
Chd5 A T 4: 152,377,055 T1275S probably benign Het
Chtf8 A T 8: 106,885,905 M134K probably benign Het
Col11a2 A T 17: 34,039,625 probably benign Het
Cyp8b1 A G 9: 121,915,618 V216A probably benign Het
Dnah8 C T 17: 30,854,937 T4527M probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Erap1 T A 13: 74,668,028 L92Q probably damaging Het
Exoc3l G T 8: 105,293,405 P296H probably damaging Het
Gm5294 A T 5: 138,820,968 N78Y probably damaging Het
Hacl1 T C 14: 31,634,191 probably benign Het
Hrnr T A 3: 93,322,855 N133K probably benign Het
Itgax G T 7: 128,136,273 R504S possibly damaging Het
Itgb4 A G 11: 116,005,926 S1461G possibly damaging Het
Klkb1 G T 8: 45,282,801 T175K probably damaging Het
Lrrk2 A T 15: 91,712,780 D525V possibly damaging Het
Lrrk2 C A 15: 91,778,504 T1912K probably damaging Het
Mdga1 G T 17: 29,857,622 Q59K probably damaging Het
Mpp4 A G 1: 59,124,683 V466A possibly damaging Het
Myh6 T C 14: 54,963,055 D203G probably benign Het
Myo5b T C 18: 74,716,037 S1116P probably damaging Het
Nemp1 T C 10: 127,695,473 L311P probably damaging Het
Nup205 A G 6: 35,219,742 R1138G probably damaging Het
Nup54 A G 5: 92,417,529 M443T probably damaging Het
Peak1 T C 9: 56,260,365 E93G probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plekhj1 A G 10: 80,797,775 I76T probably damaging Het
Poll A G 19: 45,558,418 probably benign Het
Pygm A T 19: 6,392,950 I556F probably benign Het
Ranbp2 T C 10: 58,476,472 F1005L probably benign Het
Rcor3 G T 1: 192,101,085 T361K possibly damaging Het
Robo4 A G 9: 37,402,017 probably benign Het
Rps15 T C 10: 80,293,839 V96A probably benign Het
Rrm2 T A 12: 24,709,432 N55K probably damaging Het
Shank2 T C 7: 144,128,375 Y382H probably benign Het
Slc25a10 G T 11: 120,491,993 E3* probably null Het
Slc7a8 T A 14: 54,735,841 E223V probably benign Het
Snx13 A G 12: 35,144,097 K880E probably benign Het
Spinkl T G 18: 44,168,149 M41L probably benign Het
Srp54a A C 12: 55,089,257 N19T probably benign Het
Sun2 T C 15: 79,734,155 K268E probably benign Het
Sytl1 G A 4: 133,255,624 Q359* probably null Het
Tlr6 A T 5: 64,953,595 F656L probably damaging Het
Tmem185a C T X: 70,462,186 probably null Het
Tmem45a2 C T 16: 57,039,035 D278N probably benign Het
Trav7-1 T C 14: 52,655,334 probably benign Het
Trpc2 T A 7: 102,093,574 M597K probably damaging Het
Ttc21a A G 9: 119,950,816 probably benign Het
Usp9y C T Y: 1,313,741 M2188I probably damaging Het
Utrn C A 10: 12,750,030 probably null Het
Vmn1r35 T A 6: 66,679,073 R204S probably damaging Het
Zfp955b T A 17: 33,305,416 Y59F probably damaging Het
Other mutations in Ppp1r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ppp1r3a APN 6 14755084 missense probably damaging 1.00
IGL00670:Ppp1r3a APN 6 14719060 missense probably benign 0.22
IGL00703:Ppp1r3a APN 6 14718408 missense probably benign 0.02
IGL00726:Ppp1r3a APN 6 14717852 missense probably benign 0.42
IGL00742:Ppp1r3a APN 6 14718609 missense probably benign 0.36
IGL01477:Ppp1r3a APN 6 14718346 missense probably damaging 0.99
IGL01632:Ppp1r3a APN 6 14754811 missense probably damaging 1.00
IGL02162:Ppp1r3a APN 6 14717715 missense probably damaging 1.00
IGL02374:Ppp1r3a APN 6 14718600 missense probably damaging 1.00
IGL02539:Ppp1r3a APN 6 14718459 missense probably benign 0.01
IGL02563:Ppp1r3a APN 6 14719762 missense probably benign 0.20
IGL02929:Ppp1r3a APN 6 14719811 missense probably benign 0.00
IGL03110:Ppp1r3a APN 6 14722065 splice site probably benign
IGL03290:Ppp1r3a APN 6 14754772 missense probably damaging 1.00
IGL03326:Ppp1r3a APN 6 14719766 missense probably damaging 0.96
P0041:Ppp1r3a UTSW 6 14719697 missense probably benign 0.00
PIT4445001:Ppp1r3a UTSW 6 14717777 missense probably damaging 1.00
R0015:Ppp1r3a UTSW 6 14717661 missense possibly damaging 0.58
R0077:Ppp1r3a UTSW 6 14754517 missense possibly damaging 0.64
R0368:Ppp1r3a UTSW 6 14718960 missense probably benign 0.26
R0391:Ppp1r3a UTSW 6 14719697 missense probably benign 0.43
R1793:Ppp1r3a UTSW 6 14754718 missense probably damaging 1.00
R1797:Ppp1r3a UTSW 6 14717982 missense probably benign 0.02
R1855:Ppp1r3a UTSW 6 14754994 missense probably damaging 1.00
R1864:Ppp1r3a UTSW 6 14718405 missense probably damaging 1.00
R1865:Ppp1r3a UTSW 6 14718405 missense probably damaging 1.00
R2046:Ppp1r3a UTSW 6 14722104 missense probably benign 0.12
R2122:Ppp1r3a UTSW 6 14721875 missense possibly damaging 0.95
R2437:Ppp1r3a UTSW 6 14718323 missense probably benign 0.03
R2518:Ppp1r3a UTSW 6 14719378 missense possibly damaging 0.95
R2887:Ppp1r3a UTSW 6 14718249 missense possibly damaging 0.89
R2888:Ppp1r3a UTSW 6 14718249 missense possibly damaging 0.89
R2889:Ppp1r3a UTSW 6 14718249 missense possibly damaging 0.89
R3419:Ppp1r3a UTSW 6 14719414 missense probably benign 0.01
R3886:Ppp1r3a UTSW 6 14719912 missense possibly damaging 0.87
R3937:Ppp1r3a UTSW 6 14719074 missense probably damaging 0.99
R4246:Ppp1r3a UTSW 6 14719781 missense probably damaging 1.00
R4561:Ppp1r3a UTSW 6 14754682 missense probably damaging 1.00
R4701:Ppp1r3a UTSW 6 14718993 missense probably benign 0.00
R4853:Ppp1r3a UTSW 6 14719047 missense probably benign 0.03
R5076:Ppp1r3a UTSW 6 14754681 missense probably damaging 1.00
R5085:Ppp1r3a UTSW 6 14719604 missense probably damaging 1.00
R5501:Ppp1r3a UTSW 6 14719418 missense probably benign 0.02
R5725:Ppp1r3a UTSW 6 14719349 missense probably benign 0.04
R5729:Ppp1r3a UTSW 6 14719763 missense probably benign 0.06
R5741:Ppp1r3a UTSW 6 14719883 missense probably damaging 0.97
R5841:Ppp1r3a UTSW 6 14718984 missense probably benign 0.26
R5914:Ppp1r3a UTSW 6 14718989 missense probably benign 0.09
R6091:Ppp1r3a UTSW 6 14719340 missense probably benign 0.02
R6154:Ppp1r3a UTSW 6 14754604 missense possibly damaging 0.88
R6218:Ppp1r3a UTSW 6 14718431 missense probably damaging 0.99
R6813:Ppp1r3a UTSW 6 14719571 missense probably benign 0.13
R6826:Ppp1r3a UTSW 6 14718981 nonsense probably null
R6869:Ppp1r3a UTSW 6 14754826 missense probably benign 0.39
R7109:Ppp1r3a UTSW 6 14719236 missense probably benign 0.00
R7188:Ppp1r3a UTSW 6 14719191 missense probably benign 0.00
R7262:Ppp1r3a UTSW 6 14719070 missense probably benign 0.04
R7341:Ppp1r3a UTSW 6 14718750 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCTGTCTCTCGGCAGGTAAAC -3'
(R):5'- AAGATATTACAGCTAACACCTGGG -3'

Sequencing Primer
(F):5'- CTCTCGGCAGGTAAACAAGTGTTC -3'
(R):5'- GCGGTGACAGTGGATCC -3'
Posted On2015-04-17