Incidental Mutation 'R3938:Trpc2'
ID307276
Institutional Source Beutler Lab
Gene Symbol Trpc2
Ensembl Gene ENSMUSG00000100254
Gene Nametransient receptor potential cation channel, subfamily C, member 2
Synonymstrp2, mTrp2, TRPC2a, TRPC2b, 3010009O07Rik, Trrp2
MMRRC Submission 040825-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R3938 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102083116-102096396 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102093574 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 597 (M597K)
Ref Sequence ENSEMBL: ENSMUSP00000116934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084843] [ENSMUST00000094128] [ENSMUST00000094129] [ENSMUST00000106934] [ENSMUST00000106935] [ENSMUST00000106937] [ENSMUST00000123372] [ENSMUST00000124189] [ENSMUST00000139104]
Predicted Effect unknown
Transcript: ENSMUST00000084843
AA Change: M971K
SMART Domains Protein: ENSMUSP00000081903
Gene: ENSMUSG00000070425
AA Change: M971K

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 150 1.4e-54 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 280 N/A INTRINSIC
low complexity region 297 311 N/A INTRINSIC
low complexity region 345 362 N/A INTRINSIC
low complexity region 403 415 N/A INTRINSIC
low complexity region 416 428 N/A INTRINSIC
ANK 439 469 1.58e3 SMART
low complexity region 484 496 N/A INTRINSIC
ANK 522 551 1.74e0 SMART
Pfam:TRP_2 557 619 1e-24 PFAM
Pfam:Ion_trans 716 1024 1.7e-24 PFAM
Pfam:PKD_channel 774 1019 2.4e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
coiled coil region 1122 1162 N/A INTRINSIC
low complexity region 1220 1236 N/A INTRINSIC
low complexity region 1247 1263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094128
SMART Domains Protein: ENSMUSP00000091678
Gene: ENSMUSG00000070424

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 255 3.6e-96 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000094129
AA Change: M971K
SMART Domains Protein: ENSMUSP00000091679
Gene: ENSMUSG00000070425
AA Change: M971K

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 152 1.2e-27 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 280 N/A INTRINSIC
low complexity region 297 311 N/A INTRINSIC
low complexity region 345 362 N/A INTRINSIC
low complexity region 403 415 N/A INTRINSIC
low complexity region 416 428 N/A INTRINSIC
ANK 439 469 1.58e3 SMART
low complexity region 484 496 N/A INTRINSIC
ANK 522 551 1.74e0 SMART
Pfam:TRP_2 557 619 2.8e-28 PFAM
transmembrane domain 719 741 N/A INTRINSIC
Pfam:PKD_channel 772 1019 3.8e-12 PFAM
Pfam:Ion_trans 796 1012 3.9e-31 PFAM
low complexity region 1070 1081 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
coiled coil region 1122 1162 N/A INTRINSIC
low complexity region 1220 1236 N/A INTRINSIC
low complexity region 1247 1263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106934
SMART Domains Protein: ENSMUSP00000102547
Gene: ENSMUSG00000070424

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 117 3.7e-29 PFAM
Pfam:ART 114 157 6.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106935
SMART Domains Protein: ENSMUSP00000102548
Gene: ENSMUSG00000070424

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 146 2.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106937
SMART Domains Protein: ENSMUSP00000102550
Gene: ENSMUSG00000070424

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 255 1.9e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123372
SMART Domains Protein: ENSMUSP00000121068
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 152 5.2e-29 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 280 N/A INTRINSIC
low complexity region 297 311 N/A INTRINSIC
internal_repeat_1 324 345 2.69e-6 PROSPERO
low complexity region 346 379 N/A INTRINSIC
internal_repeat_1 380 401 2.69e-6 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000124189
AA Change: M597K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116934
Gene: ENSMUSG00000100254
AA Change: M597K

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
low complexity region 42 54 N/A INTRINSIC
ANK 65 95 1.58e3 SMART
low complexity region 110 122 N/A INTRINSIC
ANK 148 177 1.74e0 SMART
Pfam:TRP_2 183 245 9.1e-29 PFAM
transmembrane domain 345 367 N/A INTRINSIC
Pfam:PKD_channel 398 645 1.4e-12 PFAM
Pfam:Ion_trans 422 638 1e-31 PFAM
low complexity region 696 707 N/A INTRINSIC
low complexity region 719 730 N/A INTRINSIC
coiled coil region 748 788 N/A INTRINSIC
low complexity region 846 862 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139104
SMART Domains Protein: ENSMUSP00000122430
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 62 3.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155078
SMART Domains Protein: ENSMUSP00000123466
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 62 4.4e-22 PFAM
Meta Mutation Damage Score 0.0724 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (57/58)
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit altered sexual and social behavior, including intermale mounting and a lack of aggressive behavior in the presence of invading males. Homozygotes for another allele show increased triglyceride levels in both males and femalesand increased cholesterol in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,154,294 P1561L probably damaging Het
Adamts1 C T 16: 85,795,619 V634M possibly damaging Het
Arid4b A T 13: 14,186,928 N659I probably benign Het
BC049715 T C 6: 136,840,455 I231T possibly damaging Het
Bmp4 T C 14: 46,384,079 Y336C probably damaging Het
Ccdc30 G A 4: 119,352,673 T293I probably benign Het
Chd5 A T 4: 152,377,055 T1275S probably benign Het
Chtf8 A T 8: 106,885,905 M134K probably benign Het
Col11a2 A T 17: 34,039,625 probably benign Het
Cyp8b1 A G 9: 121,915,618 V216A probably benign Het
Dnah8 C T 17: 30,854,937 T4527M probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Erap1 T A 13: 74,668,028 L92Q probably damaging Het
Exoc3l G T 8: 105,293,405 P296H probably damaging Het
Gm5294 A T 5: 138,820,968 N78Y probably damaging Het
Hacl1 T C 14: 31,634,191 probably benign Het
Hrnr T A 3: 93,322,855 N133K probably benign Het
Itgax G T 7: 128,136,273 R504S possibly damaging Het
Itgb4 A G 11: 116,005,926 S1461G possibly damaging Het
Klkb1 G T 8: 45,282,801 T175K probably damaging Het
Lrrk2 A T 15: 91,712,780 D525V possibly damaging Het
Lrrk2 C A 15: 91,778,504 T1912K probably damaging Het
Mdga1 G T 17: 29,857,622 Q59K probably damaging Het
Mpp4 A G 1: 59,124,683 V466A possibly damaging Het
Myh6 T C 14: 54,963,055 D203G probably benign Het
Myo5b T C 18: 74,716,037 S1116P probably damaging Het
Nemp1 T C 10: 127,695,473 L311P probably damaging Het
Nup205 A G 6: 35,219,742 R1138G probably damaging Het
Nup54 A G 5: 92,417,529 M443T probably damaging Het
Peak1 T C 9: 56,260,365 E93G probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plekhj1 A G 10: 80,797,775 I76T probably damaging Het
Poll A G 19: 45,558,418 probably benign Het
Ppp1r3a A T 6: 14,719,074 S614T probably damaging Het
Pygm A T 19: 6,392,950 I556F probably benign Het
Ranbp2 T C 10: 58,476,472 F1005L probably benign Het
Rcor3 G T 1: 192,101,085 T361K possibly damaging Het
Robo4 A G 9: 37,402,017 probably benign Het
Rps15 T C 10: 80,293,839 V96A probably benign Het
Rrm2 T A 12: 24,709,432 N55K probably damaging Het
Shank2 T C 7: 144,128,375 Y382H probably benign Het
Slc25a10 G T 11: 120,491,993 E3* probably null Het
Slc7a8 T A 14: 54,735,841 E223V probably benign Het
Snx13 A G 12: 35,144,097 K880E probably benign Het
Spinkl T G 18: 44,168,149 M41L probably benign Het
Srp54a A C 12: 55,089,257 N19T probably benign Het
Sun2 T C 15: 79,734,155 K268E probably benign Het
Sytl1 G A 4: 133,255,624 Q359* probably null Het
Tlr6 A T 5: 64,953,595 F656L probably damaging Het
Tmem185a C T X: 70,462,186 probably null Het
Tmem45a2 C T 16: 57,039,035 D278N probably benign Het
Trav7-1 T C 14: 52,655,334 probably benign Het
Ttc21a A G 9: 119,950,816 probably benign Het
Usp9y C T Y: 1,313,741 M2188I probably damaging Het
Utrn C A 10: 12,750,030 probably null Het
Vmn1r35 T A 6: 66,679,073 R204S probably damaging Het
Zfp955b T A 17: 33,305,416 Y59F probably damaging Het
Other mutations in Trpc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0443:Trpc2 UTSW 7 102093520 splice site probably benign
R0601:Trpc2 UTSW 7 102084365 missense possibly damaging 0.53
R1303:Trpc2 UTSW 7 102088161 missense probably damaging 1.00
R1493:Trpc2 UTSW 7 102090576 missense probably damaging 0.97
R1579:Trpc2 UTSW 7 102084240 missense probably damaging 0.99
R1829:Trpc2 UTSW 7 102084119 missense probably damaging 1.00
R2010:Trpc2 UTSW 7 102094573 missense probably benign
R3103:Trpc2 UTSW 7 102095234 missense possibly damaging 0.74
R3738:Trpc2 UTSW 7 102084504 missense probably damaging 1.00
R3739:Trpc2 UTSW 7 102084504 missense probably damaging 1.00
R3945:Trpc2 UTSW 7 102088279 missense possibly damaging 0.52
R3951:Trpc2 UTSW 7 102093574 missense probably damaging 1.00
R3970:Trpc2 UTSW 7 102084324 missense probably damaging 1.00
R4035:Trpc2 UTSW 7 102084504 missense probably damaging 1.00
R4234:Trpc2 UTSW 7 102088135 missense possibly damaging 0.52
R4329:Trpc2 UTSW 7 102087520 missense probably damaging 1.00
R4531:Trpc2 UTSW 7 102095998 missense probably damaging 1.00
R4857:Trpc2 UTSW 7 102083969 missense probably benign 0.18
R5058:Trpc2 UTSW 7 102089109 missense probably damaging 1.00
R5093:Trpc2 UTSW 7 102095183 missense probably benign
R5485:Trpc2 UTSW 7 102095213 frame shift probably null
R5486:Trpc2 UTSW 7 102095213 frame shift probably null
R5487:Trpc2 UTSW 7 102095213 frame shift probably null
R5782:Trpc2 UTSW 7 102083979 missense possibly damaging 0.85
R6379:Trpc2 UTSW 7 102096091 nonsense probably null
R6572:Trpc2 UTSW 7 102090006 missense probably damaging 1.00
R6674:Trpc2 UTSW 7 102096057 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- GGCTCAAAAGGCTTCATGGAC -3'
(R):5'- CCCTTGTTGTACAGAGGAGAATTTG -3'

Sequencing Primer
(F):5'- CATGGACATAGAACACCTTTGGCTG -3'
(R):5'- AGGGTCTTTGCGCCCTGTC -3'
Posted On2015-04-17