Incidental Mutation 'R3938:Arid4b'
ID307294
Institutional Source Beutler Lab
Gene Symbol Arid4b
Ensembl Gene ENSMUSG00000039219
Gene NameAT rich interactive domain 4B (RBP1-like)
Synonyms6720480E17Rik, RBBP1L1, Rbp1l1, BRCAA1, SAP180, 6330417L24Rik
MMRRC Submission 040825-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3938 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location14063232-14199603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14186928 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 659 (N659I)
Ref Sequence ENSEMBL: ENSMUSP00000106165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039538] [ENSMUST00000110534] [ENSMUST00000110536]
Predicted Effect probably benign
Transcript: ENSMUST00000039538
AA Change: N659I

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000043889
Gene: ENSMUSG00000039219
AA Change: N659I

DomainStartEndE-ValueType
TUDOR 58 114 4.13e-9 SMART
low complexity region 151 165 N/A INTRINSIC
Pfam:RBB1NT 166 264 3.4e-46 PFAM
ARID 303 394 3.81e-34 SMART
BRIGHT 307 399 4.99e-36 SMART
low complexity region 421 441 N/A INTRINSIC
low complexity region 543 562 N/A INTRINSIC
low complexity region 621 635 N/A INTRINSIC
low complexity region 704 713 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 769 785 N/A INTRINSIC
low complexity region 937 949 N/A INTRINSIC
low complexity region 954 964 N/A INTRINSIC
low complexity region 1002 1016 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
coiled coil region 1145 1182 N/A INTRINSIC
low complexity region 1186 1204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110534
AA Change: N746I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106163
Gene: ENSMUSG00000039219
AA Change: N746I

DomainStartEndE-ValueType
TUDOR 58 114 4.13e-9 SMART
low complexity region 151 165 N/A INTRINSIC
Pfam:RBB1NT 168 263 4.1e-39 PFAM
ARID 303 394 3.81e-34 SMART
BRIGHT 307 399 4.99e-36 SMART
low complexity region 421 441 N/A INTRINSIC
TUDOR 567 632 1.91e1 SMART
CHROMO 585 640 1.29e-1 SMART
low complexity region 708 722 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
low complexity region 802 815 N/A INTRINSIC
low complexity region 856 872 N/A INTRINSIC
low complexity region 1024 1036 N/A INTRINSIC
low complexity region 1041 1051 N/A INTRINSIC
low complexity region 1089 1103 N/A INTRINSIC
low complexity region 1141 1155 N/A INTRINSIC
coiled coil region 1232 1269 N/A INTRINSIC
low complexity region 1273 1291 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110536
AA Change: N659I

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106165
Gene: ENSMUSG00000039219
AA Change: N659I

DomainStartEndE-ValueType
TUDOR 58 114 4.13e-9 SMART
low complexity region 151 165 N/A INTRINSIC
Pfam:RBB1NT 166 264 3.4e-46 PFAM
ARID 303 394 3.81e-34 SMART
BRIGHT 307 399 4.99e-36 SMART
low complexity region 421 441 N/A INTRINSIC
low complexity region 543 562 N/A INTRINSIC
low complexity region 621 635 N/A INTRINSIC
low complexity region 704 713 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 769 785 N/A INTRINSIC
low complexity region 937 949 N/A INTRINSIC
low complexity region 954 964 N/A INTRINSIC
low complexity region 1002 1016 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
coiled coil region 1145 1182 N/A INTRINSIC
low complexity region 1186 1204 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149579
Predicted Effect probably benign
Transcript: ENSMUST00000151151
Meta Mutation Damage Score 0.0544 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to retinoblastoma-binding protein-1. The encoded protein is a subunit of the histone deacetylase-dependant SIN3A transcriptional corepressor complex, which functions in diverse cellular processes including proliferation, differentiation, apoptosis, oncogenesis, and cell fate determination. The gene product is recognized by IgG antibody isolated from a breast cancer patient and appears to be a molecular marker associated with a broad range of human malignancies. Alternate transcriptional splice variants encoding different isoforms have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die pre-implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,154,294 P1561L probably damaging Het
Adamts1 C T 16: 85,795,619 V634M possibly damaging Het
BC049715 T C 6: 136,840,455 I231T possibly damaging Het
Bmp4 T C 14: 46,384,079 Y336C probably damaging Het
Ccdc30 G A 4: 119,352,673 T293I probably benign Het
Chd5 A T 4: 152,377,055 T1275S probably benign Het
Chtf8 A T 8: 106,885,905 M134K probably benign Het
Col11a2 A T 17: 34,039,625 probably benign Het
Cyp8b1 A G 9: 121,915,618 V216A probably benign Het
Dnah8 C T 17: 30,854,937 T4527M probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Erap1 T A 13: 74,668,028 L92Q probably damaging Het
Exoc3l G T 8: 105,293,405 P296H probably damaging Het
Gm5294 A T 5: 138,820,968 N78Y probably damaging Het
Hacl1 T C 14: 31,634,191 probably benign Het
Hrnr T A 3: 93,322,855 N133K probably benign Het
Itgax G T 7: 128,136,273 R504S possibly damaging Het
Itgb4 A G 11: 116,005,926 S1461G possibly damaging Het
Klkb1 G T 8: 45,282,801 T175K probably damaging Het
Lrrk2 A T 15: 91,712,780 D525V possibly damaging Het
Lrrk2 C A 15: 91,778,504 T1912K probably damaging Het
Mdga1 G T 17: 29,857,622 Q59K probably damaging Het
Mpp4 A G 1: 59,124,683 V466A possibly damaging Het
Myh6 T C 14: 54,963,055 D203G probably benign Het
Myo5b T C 18: 74,716,037 S1116P probably damaging Het
Nemp1 T C 10: 127,695,473 L311P probably damaging Het
Nup205 A G 6: 35,219,742 R1138G probably damaging Het
Nup54 A G 5: 92,417,529 M443T probably damaging Het
Peak1 T C 9: 56,260,365 E93G probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plekhj1 A G 10: 80,797,775 I76T probably damaging Het
Poll A G 19: 45,558,418 probably benign Het
Ppp1r3a A T 6: 14,719,074 S614T probably damaging Het
Pygm A T 19: 6,392,950 I556F probably benign Het
Ranbp2 T C 10: 58,476,472 F1005L probably benign Het
Rcor3 G T 1: 192,101,085 T361K possibly damaging Het
Robo4 A G 9: 37,402,017 probably benign Het
Rps15 T C 10: 80,293,839 V96A probably benign Het
Rrm2 T A 12: 24,709,432 N55K probably damaging Het
Shank2 T C 7: 144,128,375 Y382H probably benign Het
Slc25a10 G T 11: 120,491,993 E3* probably null Het
Slc7a8 T A 14: 54,735,841 E223V probably benign Het
Snx13 A G 12: 35,144,097 K880E probably benign Het
Spinkl T G 18: 44,168,149 M41L probably benign Het
Srp54a A C 12: 55,089,257 N19T probably benign Het
Sun2 T C 15: 79,734,155 K268E probably benign Het
Sytl1 G A 4: 133,255,624 Q359* probably null Het
Tlr6 A T 5: 64,953,595 F656L probably damaging Het
Tmem185a C T X: 70,462,186 probably null Het
Tmem45a2 C T 16: 57,039,035 D278N probably benign Het
Trav7-1 T C 14: 52,655,334 probably benign Het
Trpc2 T A 7: 102,093,574 M597K probably damaging Het
Ttc21a A G 9: 119,950,816 probably benign Het
Usp9y C T Y: 1,313,741 M2188I probably damaging Het
Utrn C A 10: 12,750,030 probably null Het
Vmn1r35 T A 6: 66,679,073 R204S probably damaging Het
Zfp955b T A 17: 33,305,416 Y59F probably damaging Het
Other mutations in Arid4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Arid4b APN 13 14191134 unclassified probably benign
IGL00581:Arid4b APN 13 14160195 missense probably damaging 1.00
IGL00808:Arid4b APN 13 14136261 critical splice donor site probably null
IGL01150:Arid4b APN 13 14195374 nonsense probably null
IGL01570:Arid4b APN 13 14186809 unclassified probably benign
IGL01942:Arid4b APN 13 14136164 intron probably benign
IGL02031:Arid4b APN 13 14153412 splice site probably benign
IGL02183:Arid4b APN 13 14169990 missense possibly damaging 0.68
R0096:Arid4b UTSW 13 14129194 missense probably benign 0.08
R0096:Arid4b UTSW 13 14129194 missense probably benign 0.08
R0514:Arid4b UTSW 13 14184317 missense probably damaging 1.00
R0694:Arid4b UTSW 13 14187834 missense probably damaging 0.96
R0746:Arid4b UTSW 13 14143038 missense probably benign 0.01
R1624:Arid4b UTSW 13 14184394 missense probably damaging 0.99
R1625:Arid4b UTSW 13 14187114 missense probably damaging 0.99
R1812:Arid4b UTSW 13 14195429 missense probably damaging 1.00
R1891:Arid4b UTSW 13 14136236 missense possibly damaging 0.94
R1990:Arid4b UTSW 13 14132436 missense probably damaging 0.99
R2051:Arid4b UTSW 13 14187645 missense probably damaging 0.98
R2060:Arid4b UTSW 13 14195452 missense probably damaging 1.00
R2344:Arid4b UTSW 13 14153490 missense probably benign 0.26
R3605:Arid4b UTSW 13 14120241 missense probably damaging 1.00
R3606:Arid4b UTSW 13 14120241 missense probably damaging 1.00
R3844:Arid4b UTSW 13 14187060 missense probably damaging 0.99
R3909:Arid4b UTSW 13 14132484 missense probably damaging 1.00
R4394:Arid4b UTSW 13 14154972 splice site probably null
R4466:Arid4b UTSW 13 14132510 missense probably damaging 1.00
R4530:Arid4b UTSW 13 14126455 missense probably damaging 0.98
R4537:Arid4b UTSW 13 14120161 nonsense probably null
R4829:Arid4b UTSW 13 14184438 missense probably benign 0.23
R4930:Arid4b UTSW 13 14187477 missense probably damaging 0.99
R4972:Arid4b UTSW 13 14160272 missense probably benign 0.07
R5119:Arid4b UTSW 13 14164281 missense probably benign 0.15
R5236:Arid4b UTSW 13 14126449 critical splice acceptor site probably null
R5304:Arid4b UTSW 13 14186929 missense probably benign 0.34
R5439:Arid4b UTSW 13 14187696 missense probably damaging 0.99
R5734:Arid4b UTSW 13 14160271 missense probably benign 0.09
R5950:Arid4b UTSW 13 14191264 splice site probably benign
R5951:Arid4b UTSW 13 14143063 missense possibly damaging 0.80
R6645:Arid4b UTSW 13 14120152 missense probably damaging 1.00
R6765:Arid4b UTSW 13 14187315 missense possibly damaging 0.84
R6804:Arid4b UTSW 13 14129207 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- CATTGTAGAATGCTTATCTGGCTGG -3'
(R):5'- TCATCTGCACTGCAATACCG -3'

Sequencing Primer
(F):5'- GCTGGATAAGTCATGTTGCCCC -3'
(R):5'- AAAGCCTTGTCTGTTGTGTCC -3'
Posted On2015-04-17