Incidental Mutation 'R0376:Rbm15'
ID30736
Institutional Source Beutler Lab
Gene Symbol Rbm15
Ensembl Gene ENSMUSG00000048109
Gene NameRNA binding motif protein 15
Synonyms
MMRRC Submission 038582-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0376 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location107325421-107333673 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107330938 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 715 (S715G)
Ref Sequence ENSEMBL: ENSMUSP00000054424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061772]
Predicted Effect probably benign
Transcript: ENSMUST00000061772
AA Change: S715G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000054424
Gene: ENSMUSG00000048109
AA Change: S715G

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 56 96 N/A INTRINSIC
low complexity region 114 129 N/A INTRINSIC
low complexity region 133 163 N/A INTRINSIC
RRM 170 247 7.49e-5 SMART
low complexity region 268 278 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
low complexity region 313 330 N/A INTRINSIC
RRM 374 446 1.33e-10 SMART
RRM 455 524 2.51e-6 SMART
low complexity region 532 542 N/A INTRINSIC
low complexity region 564 582 N/A INTRINSIC
low complexity region 592 606 N/A INTRINSIC
internal_repeat_2 613 685 7.13e-5 PROSPERO
internal_repeat_2 677 753 7.13e-5 PROSPERO
low complexity region 754 771 N/A INTRINSIC
Pfam:SPOC 789 925 1.7e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197769
Meta Mutation Damage Score 0.1148 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.0%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the SPEN (Split-end) family of proteins, including RBM15, have repressor function in several signaling pathways and may bind to RNA through interaction with spliceosome components (Hiriart et al., 2005 [PubMed 16129689]).[supplied by OMIM, Feb 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality around E9.5. Mice homozygous for a floxed allele activate in hematopoietic cells exhibit increased megakaryocyte cell number, long-term hematopoietic stem cells, and red pulp as well as decreased B cells and leukocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik G A 2: 173,528,327 E132K probably benign Het
Adam6a T C 12: 113,544,690 Y228H probably damaging Het
Als2 A G 1: 59,215,565 F211S probably benign Het
Ankrd12 T A 17: 66,053,009 Q11L probably damaging Het
Anxa5 T C 3: 36,460,488 R115G probably damaging Het
Arhgap10 T C 8: 77,450,824 probably benign Het
Atp2a3 T A 11: 72,982,702 D782E probably damaging Het
Bcr G T 10: 75,145,327 L659F probably damaging Het
Cacna1b A G 2: 24,659,003 probably benign Het
Camp C T 9: 109,848,399 C122Y probably damaging Het
Col12a1 A T 9: 79,693,494 S769R probably benign Het
Cyp2j6 T A 4: 96,526,023 K335I probably damaging Het
Cyp3a11 A C 5: 145,862,452 Y308* probably null Het
Flnb G A 14: 7,946,014 probably null Het
Frmd4a G T 2: 4,572,387 M351I probably damaging Het
Gabrg2 C T 11: 41,916,315 S365N possibly damaging Het
Ggn T C 7: 29,173,022 V609A possibly damaging Het
H60c T C 10: 3,260,435 probably benign Het
Hexdc T A 11: 121,218,165 probably benign Het
Igsf9b A G 9: 27,334,582 T1282A probably benign Het
Ikzf4 T C 10: 128,632,756 N618S probably benign Het
Ints14 A G 9: 64,983,990 K418E probably damaging Het
Iqgap1 T C 7: 80,723,879 E1454G probably benign Het
Kif13b T C 14: 64,757,404 probably benign Het
Krt71 A C 15: 101,738,070 F328C probably damaging Het
Lama2 T C 10: 27,015,546 T2524A possibly damaging Het
Mfn2 C T 4: 147,885,526 V363I probably benign Het
Mkln1 A T 6: 31,478,018 D496V probably benign Het
Olfr450 A T 6: 42,818,292 M274L probably benign Het
Patj T A 4: 98,568,987 I1242N probably damaging Het
Pcnx C T 12: 81,974,579 probably benign Het
Plcb2 T C 2: 118,717,240 E502G probably damaging Het
Plppr4 G T 3: 117,323,091 H314Q probably benign Het
Prkcsh A G 9: 22,010,251 probably benign Het
Prr14 C T 7: 127,476,643 H181Y probably benign Het
Pus3 A T 9: 35,566,422 M317L possibly damaging Het
Pwwp2a T A 11: 43,704,672 D221E probably benign Het
Rbm28 A G 6: 29,158,928 probably benign Het
Rhobtb2 A T 14: 69,796,735 V347E probably benign Het
Rimbp2 C T 5: 128,803,861 R161Q probably damaging Het
Scgb1b27 C T 7: 34,021,897 T70I possibly damaging Het
Slc40a1 T C 1: 45,912,491 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spaca9 A G 2: 28,693,660 V104A probably benign Het
Spag7 T C 11: 70,669,190 probably benign Het
Sugp1 A G 8: 70,052,638 D85G probably damaging Het
Sun1 A G 5: 139,226,699 probably benign Het
Tcp11l1 C A 2: 104,697,505 probably benign Het
Tead3 A C 17: 28,341,365 D88E probably damaging Het
Tecpr1 A T 5: 144,207,476 V636E possibly damaging Het
Tldc2 T C 2: 157,095,305 W147R probably damaging Het
Tmem161b A G 13: 84,292,383 T125A probably benign Het
Trrap A G 5: 144,816,339 M1825V probably benign Het
Ttbk2 A G 2: 120,777,581 F186L probably damaging Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Zc3h7a T C 16: 11,156,202 M240V probably benign Het
Zc3hc1 G C 6: 30,372,790 S351W probably damaging Het
Zfp366 T C 13: 99,234,251 M493T probably benign Het
Zfp93 C T 7: 24,275,861 P424S probably damaging Het
Other mutations in Rbm15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Rbm15 APN 3 107331010 missense probably damaging 0.98
IGL01933:Rbm15 APN 3 107331103 missense probably damaging 0.99
IGL02116:Rbm15 APN 3 107330280 missense probably damaging 1.00
IGL02886:Rbm15 APN 3 107326295 missense probably benign 0.41
R0281:Rbm15 UTSW 3 107331155 missense probably damaging 0.99
R0374:Rbm15 UTSW 3 107330564 missense probably damaging 1.00
R0501:Rbm15 UTSW 3 107332530 missense possibly damaging 0.91
R0517:Rbm15 UTSW 3 107331369 missense probably damaging 1.00
R1347:Rbm15 UTSW 3 107332630 missense possibly damaging 0.53
R1347:Rbm15 UTSW 3 107332630 missense possibly damaging 0.53
R1348:Rbm15 UTSW 3 107332630 missense possibly damaging 0.53
R1372:Rbm15 UTSW 3 107332630 missense possibly damaging 0.53
R1373:Rbm15 UTSW 3 107332630 missense possibly damaging 0.53
R1377:Rbm15 UTSW 3 107330758 missense probably benign
R1616:Rbm15 UTSW 3 107330881 missense probably benign
R1708:Rbm15 UTSW 3 107331220 missense probably damaging 1.00
R1944:Rbm15 UTSW 3 107331552 missense probably damaging 1.00
R2519:Rbm15 UTSW 3 107330833 missense probably benign 0.08
R3432:Rbm15 UTSW 3 107330677 missense probably benign 0.32
R4885:Rbm15 UTSW 3 107332254 missense probably benign 0.25
R5434:Rbm15 UTSW 3 107330467 missense possibly damaging 0.70
R6915:Rbm15 UTSW 3 107332311 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGTTGAGCCCTCCACAAGTAGACTG -3'
(R):5'- AACAGCGTCACTGCACTCCTTC -3'

Sequencing Primer
(F):5'- CCTGCAACAGATGCATGTTGG -3'
(R):5'- TCTCCTGACCGAAGTCCAG -3'
Posted On2013-04-24