Incidental Mutation 'R3917:Trpv3'
ID307368
Institutional Source Beutler Lab
Gene Symbol Trpv3
Ensembl Gene ENSMUSG00000043029
Gene Nametransient receptor potential cation channel, subfamily V, member 3
SynonymsNh, VRL3, 1110036I10Rik
MMRRC Submission 040914-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R3917 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73267388-73300363 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73283734 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 309 (D309G)
Ref Sequence ENSEMBL: ENSMUSP00000053755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049676]
PDB Structure
Crystal structure of the N-terminal ankyrin repeat domain of TRPV3 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049676
AA Change: D309G

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000053755
Gene: ENSMUSG00000043029
AA Change: D309G

DomainStartEndE-ValueType
low complexity region 81 92 N/A INTRINSIC
low complexity region 109 122 N/A INTRINSIC
low complexity region 133 153 N/A INTRINSIC
ANK 167 201 1.21e2 SMART
ANK 214 243 3.54e-1 SMART
ANK 261 291 1.36e-2 SMART
ANK 340 370 6.71e-2 SMART
low complexity region 417 431 N/A INTRINSIC
Pfam:Ion_trans 437 689 3.9e-9 PFAM
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to a family of nonselective cation channels that function in a variety of processes, including temperature sensation and vasoregulation. The thermosensitive members of this family are expressed in subsets of sensory neurons that terminate in the skin, and are activated at distinct physiological temperatures. This channel is activated at temperatures between 22 and 40 degrees C. This gene lies in close proximity to another family member gene on chromosome 17, and the two encoded proteins are thought to associate with each other to form heteromeric channels. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous null mice have strong deficits in response to innocuous and noxious heat but not in other sensory modalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 A G 5: 121,599,214 V498A probably damaging Het
Adam19 A G 11: 46,060,935 E37G probably benign Het
Apol11b A G 15: 77,635,304 I192T probably benign Het
Appl1 A T 14: 26,928,604 F537Y probably damaging Het
Atad5 A C 11: 80,103,294 K785N probably null Het
Atp1b2 A G 11: 69,603,075 V93A probably damaging Het
Bcam T C 7: 19,765,450 Y216C probably damaging Het
Brca2 A G 5: 150,540,827 E1352G probably damaging Het
C030005K15Rik A C 10: 97,725,591 S93A unknown Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Ccdc88c A G 12: 100,941,107 probably null Het
Ccdc89 A G 7: 90,426,825 D81G probably damaging Het
Ccnt1 A G 15: 98,544,059 S443P probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdc42bpa T C 1: 180,106,154 probably null Het
Cdk11b T C 4: 155,626,801 S47P probably damaging Het
Cfap43 T C 19: 47,897,750 D142G probably benign Het
Cntnap4 C G 8: 112,875,533 P1190A probably benign Het
Colgalt2 T A 1: 152,508,611 Y567* probably null Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Dock7 T C 4: 99,016,685 Y651C probably damaging Het
Fzd3 A T 14: 65,235,930 F130I probably damaging Het
Gabarapl2 T A 8: 111,952,396 F115L probably benign Het
Gm1043 G A 5: 37,192,941 probably benign Het
Gm12185 A G 11: 48,915,933 F144L probably benign Het
Gm14124 T A 2: 150,266,119 probably benign Het
Gm21961 A T 15: 65,014,884 D7E unknown Het
Gtf3a A G 5: 146,955,434 K332E probably benign Het
Haao A G 17: 83,838,799 probably null Het
Habp2 T A 19: 56,311,179 C170S probably damaging Het
Heatr3 T G 8: 88,150,371 probably null Het
Herc1 T G 9: 66,434,466 C1846G possibly damaging Het
Hivep3 T C 4: 120,099,427 S1647P probably benign Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Hspg2 A G 4: 137,559,314 E3648G probably damaging Het
Jaml T C 9: 45,101,151 probably benign Het
Jund C T 8: 70,699,023 probably benign Het
Klra14-ps T C 6: 130,157,632 noncoding transcript Het
Krt88 G A 15: 101,452,928 probably null Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Lyzl4 T A 9: 121,583,035 D105V probably damaging Het
Mst1 A G 9: 108,084,295 I575V probably benign Het
Myd88 T C 9: 119,341,398 probably benign Het
Myo1d A T 11: 80,666,578 V512E probably damaging Het
Ndufv1 A G 19: 4,010,002 Y33H probably damaging Het
Nwd1 T A 8: 72,667,811 C608* probably null Het
Olfr118 T A 17: 37,672,793 F257I probably damaging Het
Olfr884 A T 9: 38,047,545 I108F probably damaging Het
Patj A T 4: 98,592,008 K1317* probably null Het
Pld5 A G 1: 175,963,938 S501P probably benign Het
Pnpo A G 11: 96,939,757 V146A probably damaging Het
Ppdpf A G 2: 181,187,728 Y16C probably benign Het
Ppp1r27 A G 11: 120,550,959 V32A possibly damaging Het
Rbm28 T C 6: 29,154,789 D294G probably benign Het
Sdk1 T A 5: 142,051,244 D817E probably damaging Het
Shank3 A G 15: 89,503,384 D252G possibly damaging Het
Slc29a1 A T 17: 45,588,973 probably null Het
Slc35a5 G C 16: 45,158,158 probably benign Het
Slc6a5 T C 7: 49,911,869 S50P probably damaging Het
Slfn8 A T 11: 83,016,993 Y241* probably null Het
Slu7 G T 11: 43,440,684 probably null Het
Smad2 T A 18: 76,287,937 D82E probably benign Het
Spx A C 6: 142,414,031 E33A probably damaging Het
Tdp1 A G 12: 99,894,717 Y205C probably damaging Het
Tekt1 A G 11: 72,345,748 I296T possibly damaging Het
Tgm1 G A 14: 55,712,757 probably benign Het
Tnks A G 8: 34,853,361 S719P probably damaging Het
Trip6 A G 5: 137,313,679 C47R probably benign Het
Tti2 A G 8: 31,153,519 K221E possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r57 A T 7: 5,220,631 N52Y probably damaging Het
Vmn2r94 A G 17: 18,244,358 F557L probably benign Het
Zbed5 T C 5: 129,902,277 Y356H possibly damaging Het
Zic4 C A 9: 91,384,341 probably benign Het
Other mutations in Trpv3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Trpv3 APN 11 73294000 critical splice donor site probably null
IGL01161:Trpv3 APN 11 73296718 splice site probably benign
IGL02130:Trpv3 APN 11 73279770 missense probably benign 0.00
IGL02957:Trpv3 APN 11 73285872 missense probably damaging 1.00
IGL03334:Trpv3 APN 11 73281665 splice site probably benign
R0103:Trpv3 UTSW 11 73293979 missense probably damaging 1.00
R0103:Trpv3 UTSW 11 73293979 missense probably damaging 1.00
R0546:Trpv3 UTSW 11 73297187 missense probably damaging 1.00
R0685:Trpv3 UTSW 11 73296814 splice site probably benign
R0969:Trpv3 UTSW 11 73278938 nonsense probably null
R1748:Trpv3 UTSW 11 73295383 missense possibly damaging 0.84
R1974:Trpv3 UTSW 11 73283688 missense probably damaging 0.99
R2015:Trpv3 UTSW 11 73279827 missense probably damaging 0.97
R3426:Trpv3 UTSW 11 73285941 missense probably damaging 1.00
R3427:Trpv3 UTSW 11 73285941 missense probably damaging 1.00
R3428:Trpv3 UTSW 11 73285941 missense probably damaging 1.00
R3618:Trpv3 UTSW 11 73295455 missense probably damaging 1.00
R3712:Trpv3 UTSW 11 73278954 missense probably benign
R3916:Trpv3 UTSW 11 73283734 missense possibly damaging 0.87
R3961:Trpv3 UTSW 11 73287420 nonsense probably null
R4242:Trpv3 UTSW 11 73277823 missense probably benign 0.43
R4277:Trpv3 UTSW 11 73296438 missense probably damaging 0.97
R4506:Trpv3 UTSW 11 73295324 missense probably benign 0.40
R4629:Trpv3 UTSW 11 73281789 missense probably damaging 0.99
R4656:Trpv3 UTSW 11 73295414 missense probably damaging 1.00
R5059:Trpv3 UTSW 11 73295323 missense probably benign 0.00
R5121:Trpv3 UTSW 11 73277834 critical splice donor site probably null
R6113:Trpv3 UTSW 11 73286018 missense probably benign 0.10
R6130:Trpv3 UTSW 11 73296483 missense possibly damaging 0.49
R6342:Trpv3 UTSW 11 73283863 missense probably damaging 1.00
R6850:Trpv3 UTSW 11 73291693 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCACTGAGCAAAGGGGAG -3'
(R):5'- TCAGAAGTGCACCACGTTTCC -3'

Sequencing Primer
(F):5'- CTGTGATGGCCAGCATCTG -3'
(R):5'- GCACCACGTTTCCCCAGC -3'
Posted On2015-04-17