Incidental Mutation 'R0376:Cyp2j6'
ID30738
Institutional Source Beutler Lab
Gene Symbol Cyp2j6
Ensembl Gene ENSMUSG00000052914
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 6
Synonyms
MMRRC Submission 038582-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R0376 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location96516138-96553661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 96526023 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Isoleucine at position 335 (K335I)
Ref Sequence ENSEMBL: ENSMUSP00000030303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030303]
Predicted Effect probably damaging
Transcript: ENSMUST00000030303
AA Change: K335I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030303
Gene: ENSMUSG00000052914
AA Change: K335I

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 44 497 6.6e-138 PFAM
Meta Mutation Damage Score 0.306 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.0%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is thought to be the predominant enzyme responsible for epoxidation of endogenous arachidonic acid in cardiac tissue. Multiple transcript variants have been found for this gene. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik G A 2: 173,528,327 E132K probably benign Het
Adam6a T C 12: 113,544,690 Y228H probably damaging Het
Als2 A G 1: 59,215,565 F211S probably benign Het
Ankrd12 T A 17: 66,053,009 Q11L probably damaging Het
Anxa5 T C 3: 36,460,488 R115G probably damaging Het
Arhgap10 T C 8: 77,450,824 probably benign Het
Atp2a3 T A 11: 72,982,702 D782E probably damaging Het
Bcr G T 10: 75,145,327 L659F probably damaging Het
Cacna1b A G 2: 24,659,003 probably benign Het
Camp C T 9: 109,848,399 C122Y probably damaging Het
Col12a1 A T 9: 79,693,494 S769R probably benign Het
Cyp3a11 A C 5: 145,862,452 Y308* probably null Het
Flnb G A 14: 7,946,014 probably null Het
Frmd4a G T 2: 4,572,387 M351I probably damaging Het
Gabrg2 C T 11: 41,916,315 S365N possibly damaging Het
Ggn T C 7: 29,173,022 V609A possibly damaging Het
H60c T C 10: 3,260,435 probably benign Het
Hexdc T A 11: 121,218,165 probably benign Het
Igsf9b A G 9: 27,334,582 T1282A probably benign Het
Ikzf4 T C 10: 128,632,756 N618S probably benign Het
Ints14 A G 9: 64,983,990 K418E probably damaging Het
Iqgap1 T C 7: 80,723,879 E1454G probably benign Het
Kif13b T C 14: 64,757,404 probably benign Het
Krt71 A C 15: 101,738,070 F328C probably damaging Het
Lama2 T C 10: 27,015,546 T2524A possibly damaging Het
Mfn2 C T 4: 147,885,526 V363I probably benign Het
Mkln1 A T 6: 31,478,018 D496V probably benign Het
Olfr450 A T 6: 42,818,292 M274L probably benign Het
Patj T A 4: 98,568,987 I1242N probably damaging Het
Pcnx C T 12: 81,974,579 probably benign Het
Plcb2 T C 2: 118,717,240 E502G probably damaging Het
Plppr4 G T 3: 117,323,091 H314Q probably benign Het
Prkcsh A G 9: 22,010,251 probably benign Het
Prr14 C T 7: 127,476,643 H181Y probably benign Het
Pus3 A T 9: 35,566,422 M317L possibly damaging Het
Pwwp2a T A 11: 43,704,672 D221E probably benign Het
Rbm15 T C 3: 107,330,938 S715G probably benign Het
Rbm28 A G 6: 29,158,928 probably benign Het
Rhobtb2 A T 14: 69,796,735 V347E probably benign Het
Rimbp2 C T 5: 128,803,861 R161Q probably damaging Het
Scgb1b27 C T 7: 34,021,897 T70I possibly damaging Het
Slc40a1 T C 1: 45,912,491 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spaca9 A G 2: 28,693,660 V104A probably benign Het
Spag7 T C 11: 70,669,190 probably benign Het
Sugp1 A G 8: 70,052,638 D85G probably damaging Het
Sun1 A G 5: 139,226,699 probably benign Het
Tcp11l1 C A 2: 104,697,505 probably benign Het
Tead3 A C 17: 28,341,365 D88E probably damaging Het
Tecpr1 A T 5: 144,207,476 V636E possibly damaging Het
Tldc2 T C 2: 157,095,305 W147R probably damaging Het
Tmem161b A G 13: 84,292,383 T125A probably benign Het
Trrap A G 5: 144,816,339 M1825V probably benign Het
Ttbk2 A G 2: 120,777,581 F186L probably damaging Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Zc3h7a T C 16: 11,156,202 M240V probably benign Het
Zc3hc1 G C 6: 30,372,790 S351W probably damaging Het
Zfp366 T C 13: 99,234,251 M493T probably benign Het
Zfp93 C T 7: 24,275,861 P424S probably damaging Het
Other mutations in Cyp2j6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Cyp2j6 APN 4 96536046 missense possibly damaging 0.78
IGL01543:Cyp2j6 APN 4 96525924 missense possibly damaging 0.78
IGL02324:Cyp2j6 APN 4 96525933 missense probably damaging 0.99
IGL02727:Cyp2j6 APN 4 96545764 missense probably benign
IGL02963:Cyp2j6 APN 4 96518184 missense probably damaging 1.00
IGL03099:Cyp2j6 APN 4 96536091 missense possibly damaging 0.65
R0109:Cyp2j6 UTSW 4 96518157 missense probably damaging 0.99
R0109:Cyp2j6 UTSW 4 96518157 missense probably damaging 0.99
R0448:Cyp2j6 UTSW 4 96545728 missense probably benign
R0471:Cyp2j6 UTSW 4 96531748 nonsense probably null
R0734:Cyp2j6 UTSW 4 96523844 splice site probably benign
R1497:Cyp2j6 UTSW 4 96531661 missense probably damaging 1.00
R1686:Cyp2j6 UTSW 4 96523777 missense probably benign 0.08
R2079:Cyp2j6 UTSW 4 96531725 missense possibly damaging 0.87
R2293:Cyp2j6 UTSW 4 96529433 missense possibly damaging 0.87
R2350:Cyp2j6 UTSW 4 96529408 missense probably damaging 1.00
R2971:Cyp2j6 UTSW 4 96531781 missense probably benign 0.06
R3927:Cyp2j6 UTSW 4 96553288 missense probably benign 0.15
R4020:Cyp2j6 UTSW 4 96518170 missense probably benign 0.03
R5087:Cyp2j6 UTSW 4 96531699 missense probably damaging 0.99
R5309:Cyp2j6 UTSW 4 96535556 missense probably damaging 1.00
R5861:Cyp2j6 UTSW 4 96545803 missense possibly damaging 0.81
R5882:Cyp2j6 UTSW 4 96535602 missense probably benign 0.00
R6123:Cyp2j6 UTSW 4 96518029 makesense probably null
R6180:Cyp2j6 UTSW 4 96536086 missense probably damaging 1.00
R6181:Cyp2j6 UTSW 4 96536086 missense probably damaging 1.00
R6182:Cyp2j6 UTSW 4 96536086 missense probably damaging 1.00
R6185:Cyp2j6 UTSW 4 96536086 missense probably damaging 1.00
R6186:Cyp2j6 UTSW 4 96536086 missense probably damaging 1.00
R6217:Cyp2j6 UTSW 4 96518161 missense probably damaging 1.00
R6784:Cyp2j6 UTSW 4 96535504 missense possibly damaging 0.70
R7038:Cyp2j6 UTSW 4 96535471 missense probably benign
R7146:Cyp2j6 UTSW 4 96545782 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGACTGCTAGAGCCCACAT -3'
(R):5'- TGCTGATCACAGTTACTCAGTTCAGGA -3'

Sequencing Primer
(F):5'- GCAGACATAATATGCCTCTGCTG -3'
(R):5'- GCTGATAAGGTCTCATAGACAGC -3'
Posted On2013-04-24