Incidental Mutation 'R3917:Ndufv1'
ID307390
Institutional Source Beutler Lab
Gene Symbol Ndufv1
Ensembl Gene ENSMUSG00000037916
Gene NameNADH dehydrogenase (ubiquinone) flavoprotein 1
Synonyms24 kDa (FP)
MMRRC Submission 040914-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.872) question?
Stock #R3917 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4007497-4012806 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4010002 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 33 (Y33H)
Ref Sequence ENSEMBL: ENSMUSP00000120223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025806] [ENSMUST00000042497] [ENSMUST00000128787] [ENSMUST00000129706] [ENSMUST00000133474] [ENSMUST00000134479] [ENSMUST00000136921] [ENSMUST00000155405]
Predicted Effect probably benign
Transcript: ENSMUST00000025806
SMART Domains Protein: ENSMUSP00000025806
Gene: ENSMUSG00000024871

DomainStartEndE-ValueType
C2 99 206 1.14e-10 SMART
low complexity region 231 243 N/A INTRINSIC
C2 259 373 5.14e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000042497
AA Change: Y112H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042967
Gene: ENSMUSG00000037916
AA Change: Y112H

DomainStartEndE-ValueType
Pfam:Complex1_51K 80 252 2.4e-52 PFAM
Pfam:SLBB 275 327 5.1e-10 PFAM
NADH_4Fe-4S 364 409 1.05e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127016
Predicted Effect probably damaging
Transcript: ENSMUST00000128787
AA Change: Y103H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123069
Gene: ENSMUSG00000037916
AA Change: Y103H

DomainStartEndE-ValueType
Pfam:Complex1_51K 71 243 1.6e-52 PFAM
Pfam:SLBB 266 318 8.6e-10 PFAM
NADH_4Fe-4S 355 400 1.05e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129706
AA Change: V115A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115653
Gene: ENSMUSG00000037916
AA Change: V115A

DomainStartEndE-ValueType
Pfam:Complex1_51K 80 115 1.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132747
Predicted Effect probably damaging
Transcript: ENSMUST00000133474
AA Change: Y33H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120223
Gene: ENSMUSG00000037916
AA Change: Y33H

DomainStartEndE-ValueType
Pfam:Complex1_51K 1 146 3.3e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134049
Predicted Effect possibly damaging
Transcript: ENSMUST00000134479
AA Change: Y33H

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121915
Gene: ENSMUSG00000037916
AA Change: Y33H

DomainStartEndE-ValueType
Pfam:Complex1_51K 1 173 3.6e-53 PFAM
Pfam:SLBB 196 248 5.2e-11 PFAM
NADH_4Fe-4S 285 330 1.05e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000136921
AA Change: Y33H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123680
Gene: ENSMUSG00000037916
AA Change: Y33H

DomainStartEndE-ValueType
Pfam:Complex1_51K 1 114 6.7e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150852
Predicted Effect probably benign
Transcript: ENSMUST00000155405
SMART Domains Protein: ENSMUSP00000119218
Gene: ENSMUSG00000024869

DomainStartEndE-ValueType
Pfam:NUDIX 29 159 8.1e-15 PFAM
Meta Mutation Damage Score 0.53 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: This gene encodes a subunit of the NADH-ubiquinone oxidoreductase (complex I) enzyme, which is a large, multimeric protein. It is the first enzyme complex in the mitochondrial electron transport chain and catalyzes the transfer of electrons from NADH to the electron acceptor ubiquinone. The proton gradient created by electron transfer drives the conversion of ADP to ATP. This gene is a core subunit and is conserved in prokaryotes and eukaryotes. The human ortholog of this protein has been characterized. It has consensus motifs for NADH, flavin mononucleotide, and iron-sulfur binding sites and participates in the oxidation of NADH as part of the dehydrogenase module of complex I. In humans, deficiencies in complex I are associated with myopathies, encephalomyopathies, and neurodegenerative disorders. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 A G 5: 121,599,214 V498A probably damaging Het
Adam19 A G 11: 46,060,935 E37G probably benign Het
Apol11b A G 15: 77,635,304 I192T probably benign Het
Appl1 A T 14: 26,928,604 F537Y probably damaging Het
Atad5 A C 11: 80,103,294 K785N probably null Het
Atp1b2 A G 11: 69,603,075 V93A probably damaging Het
Bcam T C 7: 19,765,450 Y216C probably damaging Het
Brca2 A G 5: 150,540,827 E1352G probably damaging Het
C030005K15Rik A C 10: 97,725,591 S93A unknown Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Ccdc88c A G 12: 100,941,107 probably null Het
Ccdc89 A G 7: 90,426,825 D81G probably damaging Het
Ccnt1 A G 15: 98,544,059 S443P probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdc42bpa T C 1: 180,106,154 probably null Het
Cdk11b T C 4: 155,626,801 S47P probably damaging Het
Cfap43 T C 19: 47,897,750 D142G probably benign Het
Cntnap4 C G 8: 112,875,533 P1190A probably benign Het
Colgalt2 T A 1: 152,508,611 Y567* probably null Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Dock7 T C 4: 99,016,685 Y651C probably damaging Het
Fzd3 A T 14: 65,235,930 F130I probably damaging Het
Gabarapl2 T A 8: 111,952,396 F115L probably benign Het
Gm1043 G A 5: 37,192,941 probably benign Het
Gm12185 A G 11: 48,915,933 F144L probably benign Het
Gm14124 T A 2: 150,266,119 probably benign Het
Gm21961 A T 15: 65,014,884 D7E unknown Het
Gtf3a A G 5: 146,955,434 K332E probably benign Het
Haao A G 17: 83,838,799 probably null Het
Habp2 T A 19: 56,311,179 C170S probably damaging Het
Heatr3 T G 8: 88,150,371 probably null Het
Herc1 T G 9: 66,434,466 C1846G possibly damaging Het
Hivep3 T C 4: 120,099,427 S1647P probably benign Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Hspg2 A G 4: 137,559,314 E3648G probably damaging Het
Jaml T C 9: 45,101,151 probably benign Het
Jund C T 8: 70,699,023 probably benign Het
Klra14-ps T C 6: 130,157,632 noncoding transcript Het
Krt88 G A 15: 101,452,928 probably null Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Lyzl4 T A 9: 121,583,035 D105V probably damaging Het
Mst1 A G 9: 108,084,295 I575V probably benign Het
Myd88 T C 9: 119,341,398 probably benign Het
Myo1d A T 11: 80,666,578 V512E probably damaging Het
Nwd1 T A 8: 72,667,811 C608* probably null Het
Olfr118 T A 17: 37,672,793 F257I probably damaging Het
Olfr884 A T 9: 38,047,545 I108F probably damaging Het
Patj A T 4: 98,592,008 K1317* probably null Het
Pld5 A G 1: 175,963,938 S501P probably benign Het
Pnpo A G 11: 96,939,757 V146A probably damaging Het
Ppdpf A G 2: 181,187,728 Y16C probably benign Het
Ppp1r27 A G 11: 120,550,959 V32A possibly damaging Het
Rbm28 T C 6: 29,154,789 D294G probably benign Het
Sdk1 T A 5: 142,051,244 D817E probably damaging Het
Shank3 A G 15: 89,503,384 D252G possibly damaging Het
Slc29a1 A T 17: 45,588,973 probably null Het
Slc35a5 G C 16: 45,158,158 probably benign Het
Slc6a5 T C 7: 49,911,869 S50P probably damaging Het
Slfn8 A T 11: 83,016,993 Y241* probably null Het
Slu7 G T 11: 43,440,684 probably null Het
Smad2 T A 18: 76,287,937 D82E probably benign Het
Spx A C 6: 142,414,031 E33A probably damaging Het
Tdp1 A G 12: 99,894,717 Y205C probably damaging Het
Tekt1 A G 11: 72,345,748 I296T possibly damaging Het
Tgm1 G A 14: 55,712,757 probably benign Het
Tnks A G 8: 34,853,361 S719P probably damaging Het
Trip6 A G 5: 137,313,679 C47R probably benign Het
Trpv3 A G 11: 73,283,734 D309G possibly damaging Het
Tti2 A G 8: 31,153,519 K221E possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r57 A T 7: 5,220,631 N52Y probably damaging Het
Vmn2r94 A G 17: 18,244,358 F557L probably benign Het
Zbed5 T C 5: 129,902,277 Y356H possibly damaging Het
Zic4 C A 9: 91,384,341 probably benign Het
Other mutations in Ndufv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01861:Ndufv1 APN 19 4008803 missense probably benign 0.03
IGL02376:Ndufv1 APN 19 4007823 unclassified probably null
R1929:Ndufv1 UTSW 19 4008347 missense probably benign 0.11
R2270:Ndufv1 UTSW 19 4008347 missense probably benign 0.11
R2271:Ndufv1 UTSW 19 4008347 missense probably benign 0.11
R4844:Ndufv1 UTSW 19 4012574 missense probably benign 0.00
R4875:Ndufv1 UTSW 19 4012653 splice site probably null
R5188:Ndufv1 UTSW 19 4009988 missense probably damaging 1.00
R5853:Ndufv1 UTSW 19 4008811 splice site probably null
R6614:Ndufv1 UTSW 19 4008749 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- AGCGCTCATGTTCTCACCTG -3'
(R):5'- TCTCAGGAGAACATGGCTTATC -3'

Sequencing Primer
(F):5'- GTTCTCACCTGCAAATTGGAG -3'
(R):5'- ACATGGCTTATCTTGTGGACATACG -3'
Posted On2015-04-17