Incidental Mutation 'R3940:Ankrd16'
ID307398
Institutional Source Beutler Lab
Gene Symbol Ankrd16
Ensembl Gene ENSMUSG00000047909
Gene Nameankyrin repeat domain 16
Synonyms2810455F06Rik, D430029B21Rik
MMRRC Submission 040922-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R3940 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location11777876-11790329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11784381 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 260 (C260R)
Ref Sequence ENSEMBL: ENSMUSP00000052056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056108] [ENSMUST00000133664] [ENSMUST00000156067]
Predicted Effect probably benign
Transcript: ENSMUST00000056108
AA Change: C260R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052056
Gene: ENSMUSG00000047909
AA Change: C260R

DomainStartEndE-ValueType
ANK 36 66 1.15e0 SMART
ANK 70 99 7.95e-4 SMART
ANK 103 132 1.59e-3 SMART
ANK 136 167 1.74e0 SMART
ANK 170 200 7.71e-2 SMART
ANK 204 233 5.01e-1 SMART
ANK 238 268 1.37e2 SMART
ANK 273 302 7.53e-5 SMART
ANK 306 336 4.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125024
Predicted Effect unknown
Transcript: ENSMUST00000128774
AA Change: C30R
SMART Domains Protein: ENSMUSP00000121218
Gene: ENSMUSG00000047909
AA Change: C30R

DomainStartEndE-ValueType
Pfam:Ank_4 10 65 1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133664
SMART Domains Protein: ENSMUSP00000115226
Gene: ENSMUSG00000047909

DomainStartEndE-ValueType
Pfam:Ank 1 29 1.5e-3 PFAM
Pfam:Ank_4 1 51 7.3e-11 PFAM
Pfam:Ank_2 1 56 8.9e-11 PFAM
Pfam:Ank_5 18 56 1.8e-6 PFAM
Pfam:Ank 30 55 3e-5 PFAM
Pfam:Ank_3 30 55 2.7e-3 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150320
Predicted Effect probably benign
Transcript: ENSMUST00000156067
SMART Domains Protein: ENSMUSP00000115525
Gene: ENSMUSG00000047909

DomainStartEndE-ValueType
ANK 36 66 1.15e0 SMART
ANK 70 99 7.95e-4 SMART
ANK 103 132 1.59e-3 SMART
ANK 136 165 9.46e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194100
Meta Mutation Damage Score 0.1324 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 95% (35/37)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Acsm3 A G 7: 119,773,886 E204G probably benign Het
Acta2 A T 19: 34,243,480 I276N possibly damaging Het
Ankrd42 T C 7: 92,591,788 probably null Het
Atp13a2 T C 4: 141,006,422 S1041P probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Calm5 A T 13: 3,854,485 I37F possibly damaging Het
Casq1 A G 1: 172,219,536 V52A possibly damaging Het
Col22a1 A T 15: 71,981,933 L260* probably null Het
Cttnbp2 C A 6: 18,420,975 V846L probably benign Het
Dnah12 A G 14: 26,723,599 T627A probably benign Het
Eogt T C 6: 97,113,914 I421M probably damaging Het
Fam135a T A 1: 24,057,475 H63L probably damaging Het
Fmo3 T A 1: 162,963,986 T241S probably benign Het
Frem3 T C 8: 80,615,020 I1314T possibly damaging Het
Gm14393 T C 2: 175,061,627 probably null Het
Kcna5 C T 6: 126,533,651 V505I probably damaging Het
Kit A G 5: 75,609,318 D130G probably benign Het
Neto2 G A 8: 85,674,118 T16I probably damaging Het
Olfr1090 T A 2: 86,753,931 D269V possibly damaging Het
Olfr57 T A 10: 79,035,204 I136N probably damaging Het
Pcdhb7 T C 18: 37,343,968 L719P probably damaging Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pik3ip1 A G 11: 3,331,987 N48S probably damaging Het
Pkn2 G A 3: 142,793,911 S951L probably damaging Het
Prrc2a T C 17: 35,157,498 H772R possibly damaging Het
Ric1 T C 19: 29,570,762 Y277H probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf123 A T 9: 108,064,035 probably benign Het
Robo1 T C 16: 73,009,743 S1166P probably benign Het
S100a10 A G 3: 93,561,076 E38G probably benign Het
Slc34a1 A T 13: 55,413,170 I483F probably damaging Het
Stim1 A G 7: 102,435,641 N600S probably benign Het
Ube3c T A 5: 29,619,360 N517K probably benign Het
Other mutations in Ankrd16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01663:Ankrd16 APN 2 11778662 missense probably damaging 1.00
R0280:Ankrd16 UTSW 2 11781501 missense probably damaging 1.00
R0521:Ankrd16 UTSW 2 11789881 missense probably benign
R1441:Ankrd16 UTSW 2 11778746 missense probably damaging 1.00
R1699:Ankrd16 UTSW 2 11784393 missense probably benign
R1858:Ankrd16 UTSW 2 11778596 missense probably benign
R1944:Ankrd16 UTSW 2 11783632 splice site probably null
R2074:Ankrd16 UTSW 2 11789748 missense possibly damaging 0.82
R2104:Ankrd16 UTSW 2 11779900 intron probably benign
R2131:Ankrd16 UTSW 2 11783695 missense probably damaging 1.00
R3847:Ankrd16 UTSW 2 11789808 missense probably benign 0.04
R4424:Ankrd16 UTSW 2 11784404 missense possibly damaging 0.95
R4707:Ankrd16 UTSW 2 11778797 missense probably damaging 1.00
R4863:Ankrd16 UTSW 2 11784316 missense probably benign 0.05
R5026:Ankrd16 UTSW 2 11789881 missense probably benign 0.05
R5079:Ankrd16 UTSW 2 11778899 missense probably damaging 1.00
R5251:Ankrd16 UTSW 2 11778741 missense probably damaging 1.00
R5304:Ankrd16 UTSW 2 11789734 missense probably benign
R5746:Ankrd16 UTSW 2 11784367 missense probably damaging 0.99
R6932:Ankrd16 UTSW 2 11786243 missense possibly damaging 0.90
R6958:Ankrd16 UTSW 2 11779793 missense probably damaging 1.00
Z1088:Ankrd16 UTSW 2 11779818 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GATCACATTTCCCTTGAAGTCC -3'
(R):5'- AAGACTGAGAATCACAGGCATTTC -3'

Sequencing Primer
(F):5'- CCTTGAAGTCCTTTGAGAACCAG -3'
(R):5'- GAATCACAGGCATTTCAGGAATATAG -3'
Posted On2015-04-17