Incidental Mutation 'R0376:Mfn2'
ID30740
Institutional Source Beutler Lab
Gene Symbol Mfn2
Ensembl Gene ENSMUSG00000029020
Gene Namemitofusin 2
Synonymshypertension related protein 1, D630023P19Rik, Fzo
MMRRC Submission 038582-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0376 (G1)
Quality Score192
Status Validated
Chromosome4
Chromosomal Location147873599-147904704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 147885526 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 363 (V363I)
Ref Sequence ENSEMBL: ENSMUSP00000101341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030884] [ENSMUST00000105714] [ENSMUST00000105715] [ENSMUST00000105716] [ENSMUST00000134172]
Predicted Effect probably benign
Transcript: ENSMUST00000030884
AA Change: V363I

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030884
Gene: ENSMUSG00000029020
AA Change: V363I

DomainStartEndE-ValueType
Pfam:MMR_HSR1 98 258 3.8e-6 PFAM
Pfam:Dynamin_N 99 259 2e-24 PFAM
low complexity region 336 347 N/A INTRINSIC
coiled coil region 406 433 N/A INTRINSIC
Pfam:Fzo_mitofusin 594 754 1.6e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105714
AA Change: V363I

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101339
Gene: ENSMUSG00000029020
AA Change: V363I

DomainStartEndE-ValueType
Pfam:MMR_HSR1 98 258 6.1e-7 PFAM
Pfam:Dynamin_N 99 259 3.6e-25 PFAM
low complexity region 336 347 N/A INTRINSIC
coiled coil region 406 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105715
AA Change: V363I

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101340
Gene: ENSMUSG00000029020
AA Change: V363I

DomainStartEndE-ValueType
Pfam:MMR_HSR1 98 258 9e-7 PFAM
Pfam:Dynamin_N 99 259 5.4e-25 PFAM
low complexity region 336 347 N/A INTRINSIC
coiled coil region 406 433 N/A INTRINSIC
Pfam:Fzo_mitofusin 586 756 3.9e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105716
AA Change: V363I

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101341
Gene: ENSMUSG00000029020
AA Change: V363I

DomainStartEndE-ValueType
Pfam:MMR_HSR1 98 258 9e-7 PFAM
Pfam:Dynamin_N 99 259 5.4e-25 PFAM
low complexity region 336 347 N/A INTRINSIC
coiled coil region 406 433 N/A INTRINSIC
Pfam:Fzo_mitofusin 586 756 3.9e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124646
Predicted Effect probably benign
Transcript: ENSMUST00000134172
SMART Domains Protein: ENSMUSP00000123021
Gene: ENSMUSG00000029020

DomainStartEndE-ValueType
Pfam:Dynamin_N 99 208 5.1e-16 PFAM
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.0%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. This protein is involved in the regulation of vascular smooth muscle cell proliferation, and it may play a role in the pathophysiology of obesity. Mutations in this gene cause Charcot-Marie-Tooth disease type 2A2, and hereditary motor and sensory neuropathy VI, which are both disorders of the peripheral nervous system. Defects in this gene have also been associated with early-onset stroke. Two transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die in mid-gestation. Structural and functional abnormalities of mitochondria are reported. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik G A 2: 173,528,327 E132K probably benign Het
Adam6a T C 12: 113,544,690 Y228H probably damaging Het
Als2 A G 1: 59,215,565 F211S probably benign Het
Ankrd12 T A 17: 66,053,009 Q11L probably damaging Het
Anxa5 T C 3: 36,460,488 R115G probably damaging Het
Arhgap10 T C 8: 77,450,824 probably benign Het
Atp2a3 T A 11: 72,982,702 D782E probably damaging Het
Bcr G T 10: 75,145,327 L659F probably damaging Het
Cacna1b A G 2: 24,659,003 probably benign Het
Camp C T 9: 109,848,399 C122Y probably damaging Het
Col12a1 A T 9: 79,693,494 S769R probably benign Het
Cyp2j6 T A 4: 96,526,023 K335I probably damaging Het
Cyp3a11 A C 5: 145,862,452 Y308* probably null Het
Flnb G A 14: 7,946,014 probably null Het
Frmd4a G T 2: 4,572,387 M351I probably damaging Het
Gabrg2 C T 11: 41,916,315 S365N possibly damaging Het
Ggn T C 7: 29,173,022 V609A possibly damaging Het
H60c T C 10: 3,260,435 probably benign Het
Hexdc T A 11: 121,218,165 probably benign Het
Igsf9b A G 9: 27,334,582 T1282A probably benign Het
Ikzf4 T C 10: 128,632,756 N618S probably benign Het
Ints14 A G 9: 64,983,990 K418E probably damaging Het
Iqgap1 T C 7: 80,723,879 E1454G probably benign Het
Kif13b T C 14: 64,757,404 probably benign Het
Krt71 A C 15: 101,738,070 F328C probably damaging Het
Lama2 T C 10: 27,015,546 T2524A possibly damaging Het
Mkln1 A T 6: 31,478,018 D496V probably benign Het
Olfr450 A T 6: 42,818,292 M274L probably benign Het
Patj T A 4: 98,568,987 I1242N probably damaging Het
Pcnx C T 12: 81,974,579 probably benign Het
Plcb2 T C 2: 118,717,240 E502G probably damaging Het
Plppr4 G T 3: 117,323,091 H314Q probably benign Het
Prkcsh A G 9: 22,010,251 probably benign Het
Prr14 C T 7: 127,476,643 H181Y probably benign Het
Pus3 A T 9: 35,566,422 M317L possibly damaging Het
Pwwp2a T A 11: 43,704,672 D221E probably benign Het
Rbm15 T C 3: 107,330,938 S715G probably benign Het
Rbm28 A G 6: 29,158,928 probably benign Het
Rhobtb2 A T 14: 69,796,735 V347E probably benign Het
Rimbp2 C T 5: 128,803,861 R161Q probably damaging Het
Scgb1b27 C T 7: 34,021,897 T70I possibly damaging Het
Slc40a1 T C 1: 45,912,491 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spaca9 A G 2: 28,693,660 V104A probably benign Het
Spag7 T C 11: 70,669,190 probably benign Het
Sugp1 A G 8: 70,052,638 D85G probably damaging Het
Sun1 A G 5: 139,226,699 probably benign Het
Tcp11l1 C A 2: 104,697,505 probably benign Het
Tead3 A C 17: 28,341,365 D88E probably damaging Het
Tecpr1 A T 5: 144,207,476 V636E possibly damaging Het
Tldc2 T C 2: 157,095,305 W147R probably damaging Het
Tmem161b A G 13: 84,292,383 T125A probably benign Het
Trrap A G 5: 144,816,339 M1825V probably benign Het
Ttbk2 A G 2: 120,777,581 F186L probably damaging Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Zc3h7a T C 16: 11,156,202 M240V probably benign Het
Zc3hc1 G C 6: 30,372,790 S351W probably damaging Het
Zfp366 T C 13: 99,234,251 M493T probably benign Het
Zfp93 C T 7: 24,275,861 P424S probably damaging Het
Other mutations in Mfn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Mfn2 APN 4 147885490 missense probably damaging 1.00
IGL03236:Mfn2 APN 4 147882105 missense probably damaging 1.00
milkshake UTSW 4 147887452 missense probably benign 0.12
R0066:Mfn2 UTSW 4 147885445 unclassified probably benign
R0066:Mfn2 UTSW 4 147885445 unclassified probably benign
R0326:Mfn2 UTSW 4 147883288 missense probably damaging 1.00
R0564:Mfn2 UTSW 4 147883255 missense probably damaging 1.00
R0962:Mfn2 UTSW 4 147882201 missense probably benign
R1595:Mfn2 UTSW 4 147894696 missense probably benign 0.08
R2105:Mfn2 UTSW 4 147888705 nonsense probably null
R2260:Mfn2 UTSW 4 147894606 nonsense probably null
R4544:Mfn2 UTSW 4 147887452 missense probably benign 0.12
R4546:Mfn2 UTSW 4 147887452 missense probably benign 0.12
R4561:Mfn2 UTSW 4 147877035 missense probably damaging 1.00
R5151:Mfn2 UTSW 4 147886328 missense probably benign 0.10
R5355:Mfn2 UTSW 4 147894578 missense probably damaging 1.00
R6645:Mfn2 UTSW 4 147894612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACAAGGAGCCTGCCTTACTGTG -3'
(R):5'- AGTTTCCTCATCAGCACTGCCG -3'

Sequencing Primer
(F):5'- GATGAGACACCAGATGGCCC -3'
(R):5'- ATCAGCACTGCCGTTCTC -3'
Posted On2013-04-24