Incidental Mutation 'R3940:Kcna5'
ID307409
Institutional Source Beutler Lab
Gene Symbol Kcna5
Ensembl Gene ENSMUSG00000045534
Gene Namepotassium voltage-gated channel, shaker-related subfamily, member 5
SynonymsKv1.5
MMRRC Submission 040922-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R3940 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location126532551-126535412 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 126533651 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 505 (V505I)
Ref Sequence ENSEMBL: ENSMUSP00000055673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060972]
Predicted Effect probably damaging
Transcript: ENSMUST00000060972
AA Change: V505I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055673
Gene: ENSMUSG00000045534
AA Change: V505I

DomainStartEndE-ValueType
low complexity region 65 80 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
BTB 111 211 5e-7 SMART
Pfam:Ion_trans 240 516 6.6e-54 PFAM
Pfam:Ion_trans_2 424 509 1.4e-15 PFAM
Meta Mutation Damage Score 0.324 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 95% (35/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ino channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, the function of which could restore the resting membrane potential of beta cells after depolarization and thereby contribute to the regulation of insulin secretion. This gene is intronless, and the gene is clustered with genes KCNA1 and KCNA6 on chromosome 12. Defects in this gene are a cause of familial atrial fibrillation type 7 (ATFB7). [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal microglial proliferation and nitric oxide release after LPS treatment or facial nerve lesion. Mice homozygous for a knock-in allele exhibit impaired hypoxic pulmonary vasoconstriction, and resistance to drug-induced cardiac QT prolongation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Acsm3 A G 7: 119,773,886 E204G probably benign Het
Acta2 A T 19: 34,243,480 I276N possibly damaging Het
Ankrd16 T C 2: 11,784,381 C260R probably benign Het
Ankrd42 T C 7: 92,591,788 probably null Het
Atp13a2 T C 4: 141,006,422 S1041P probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Calm5 A T 13: 3,854,485 I37F possibly damaging Het
Casq1 A G 1: 172,219,536 V52A possibly damaging Het
Col22a1 A T 15: 71,981,933 L260* probably null Het
Cttnbp2 C A 6: 18,420,975 V846L probably benign Het
Dnah12 A G 14: 26,723,599 T627A probably benign Het
Eogt T C 6: 97,113,914 I421M probably damaging Het
Fam135a T A 1: 24,057,475 H63L probably damaging Het
Fmo3 T A 1: 162,963,986 T241S probably benign Het
Frem3 T C 8: 80,615,020 I1314T possibly damaging Het
Gm14393 T C 2: 175,061,627 probably null Het
Kit A G 5: 75,609,318 D130G probably benign Het
Neto2 G A 8: 85,674,118 T16I probably damaging Het
Olfr1090 T A 2: 86,753,931 D269V possibly damaging Het
Olfr57 T A 10: 79,035,204 I136N probably damaging Het
Pcdhb7 T C 18: 37,343,968 L719P probably damaging Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pik3ip1 A G 11: 3,331,987 N48S probably damaging Het
Pkn2 G A 3: 142,793,911 S951L probably damaging Het
Prrc2a T C 17: 35,157,498 H772R possibly damaging Het
Ric1 T C 19: 29,570,762 Y277H probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf123 A T 9: 108,064,035 probably benign Het
Robo1 T C 16: 73,009,743 S1166P probably benign Het
S100a10 A G 3: 93,561,076 E38G probably benign Het
Slc34a1 A T 13: 55,413,170 I483F probably damaging Het
Stim1 A G 7: 102,435,641 N600S probably benign Het
Ube3c T A 5: 29,619,360 N517K probably benign Het
Other mutations in Kcna5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02379:Kcna5 APN 6 126534509 missense probably damaging 1.00
H8562:Kcna5 UTSW 6 126533423 missense probably damaging 0.98
R0137:Kcna5 UTSW 6 126533383 missense probably damaging 1.00
R0881:Kcna5 UTSW 6 126534994 missense probably benign
R1436:Kcna5 UTSW 6 126534761 missense probably damaging 0.99
R1561:Kcna5 UTSW 6 126534583 missense probably damaging 1.00
R1730:Kcna5 UTSW 6 126533860 missense probably damaging 1.00
R1783:Kcna5 UTSW 6 126533860 missense probably damaging 1.00
R4276:Kcna5 UTSW 6 126533366 missense probably damaging 1.00
R4372:Kcna5 UTSW 6 126533357 makesense probably null
R4562:Kcna5 UTSW 6 126534340 missense probably benign 0.00
R5130:Kcna5 UTSW 6 126534533 missense probably benign 0.01
R5137:Kcna5 UTSW 6 126533983 missense probably damaging 1.00
R5388:Kcna5 UTSW 6 126534896 missense probably benign 0.04
R5890:Kcna5 UTSW 6 126534736 missense probably damaging 1.00
R7159:Kcna5 UTSW 6 126533629 missense probably damaging 1.00
R7162:Kcna5 UTSW 6 126533843 missense possibly damaging 0.87
R7322:Kcna5 UTSW 6 126533791 missense possibly damaging 0.83
R7353:Kcna5 UTSW 6 126534845 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCTTGGCCTTTAGGTGACAC -3'
(R):5'- AATCAGGGGTCGCACTTCTC -3'

Sequencing Primer
(F):5'- ATACTGTCAGTACTCTCCAGGGG -3'
(R):5'- CCAGTATCCCGGATGCATTCTG -3'
Posted On2015-04-17