Incidental Mutation 'R3940:Neto2'
ID307414
Institutional Source Beutler Lab
Gene Symbol Neto2
Ensembl Gene ENSMUSG00000036902
Gene Nameneuropilin (NRP) and tolloid (TLL)-like 2
Synonyms
MMRRC Submission 040922-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R3940 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location85636588-85700924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85674118 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 16 (T16I)
Ref Sequence ENSEMBL: ENSMUSP00000148172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109686] [ENSMUST00000209479] [ENSMUST00000216286]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109686
AA Change: T51I

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105308
Gene: ENSMUSG00000036902
AA Change: T51I

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
CUB 80 194 2.56e-40 SMART
CUB 205 320 9.11e-5 SMART
LDLa 324 361 5.73e-5 SMART
transmembrane domain 374 396 N/A INTRINSIC
coiled coil region 432 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209259
Predicted Effect probably damaging
Transcript: ENSMUST00000209479
AA Change: T16I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215046
Predicted Effect probably benign
Transcript: ENSMUST00000216286
AA Change: T16I

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 95% (35/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in rats encodes a protein that modulates glutamate signaling in the brain by regulating kainate receptor function. Expression of this gene may be a biomarker for proliferating infantile hemangiomas. A pseudogene of this gene is located on the long arm of chromosome 8. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null mutation show normal brain morphology and kainate receptor mediated excitatory postsynaptic currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Acsm3 A G 7: 119,773,886 E204G probably benign Het
Acta2 A T 19: 34,243,480 I276N possibly damaging Het
Ankrd16 T C 2: 11,784,381 C260R probably benign Het
Ankrd42 T C 7: 92,591,788 probably null Het
Atp13a2 T C 4: 141,006,422 S1041P probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Calm5 A T 13: 3,854,485 I37F possibly damaging Het
Casq1 A G 1: 172,219,536 V52A possibly damaging Het
Col22a1 A T 15: 71,981,933 L260* probably null Het
Cttnbp2 C A 6: 18,420,975 V846L probably benign Het
Dnah12 A G 14: 26,723,599 T627A probably benign Het
Eogt T C 6: 97,113,914 I421M probably damaging Het
Fam135a T A 1: 24,057,475 H63L probably damaging Het
Fmo3 T A 1: 162,963,986 T241S probably benign Het
Frem3 T C 8: 80,615,020 I1314T possibly damaging Het
Gm14393 T C 2: 175,061,627 probably null Het
Kcna5 C T 6: 126,533,651 V505I probably damaging Het
Kit A G 5: 75,609,318 D130G probably benign Het
Olfr1090 T A 2: 86,753,931 D269V possibly damaging Het
Olfr57 T A 10: 79,035,204 I136N probably damaging Het
Pcdhb7 T C 18: 37,343,968 L719P probably damaging Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pik3ip1 A G 11: 3,331,987 N48S probably damaging Het
Pkn2 G A 3: 142,793,911 S951L probably damaging Het
Prrc2a T C 17: 35,157,498 H772R possibly damaging Het
Ric1 T C 19: 29,570,762 Y277H probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf123 A T 9: 108,064,035 probably benign Het
Robo1 T C 16: 73,009,743 S1166P probably benign Het
S100a10 A G 3: 93,561,076 E38G probably benign Het
Slc34a1 A T 13: 55,413,170 I483F probably damaging Het
Stim1 A G 7: 102,435,641 N600S probably benign Het
Ube3c T A 5: 29,619,360 N517K probably benign Het
Other mutations in Neto2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Neto2 APN 8 85641003 missense probably damaging 1.00
IGL01938:Neto2 APN 8 85690855 missense probably benign 0.00
IGL02238:Neto2 APN 8 85669663 missense probably damaging 0.99
IGL02605:Neto2 APN 8 85663435 splice site probably benign
IGL02813:Neto2 APN 8 85690886 missense probably benign
R0138:Neto2 UTSW 8 85641044 missense possibly damaging 0.72
R1934:Neto2 UTSW 8 85670404 missense possibly damaging 0.96
R2402:Neto2 UTSW 8 85690912 missense probably benign 0.00
R2423:Neto2 UTSW 8 85669767 missense probably damaging 1.00
R3821:Neto2 UTSW 8 85663295 nonsense probably null
R3822:Neto2 UTSW 8 85663295 nonsense probably null
R3883:Neto2 UTSW 8 85663265 missense probably damaging 1.00
R3939:Neto2 UTSW 8 85674118 missense probably damaging 0.99
R3941:Neto2 UTSW 8 85674118 missense probably damaging 0.99
R4433:Neto2 UTSW 8 85641083 missense probably damaging 1.00
R4668:Neto2 UTSW 8 85641062 missense probably damaging 1.00
R4675:Neto2 UTSW 8 85669704 missense probably damaging 1.00
R4908:Neto2 UTSW 8 85669764 missense probably damaging 0.99
R5459:Neto2 UTSW 8 85670483 missense probably benign 0.35
R5471:Neto2 UTSW 8 85640760 missense probably benign 0.41
R5544:Neto2 UTSW 8 85647877 missense possibly damaging 0.94
R5571:Neto2 UTSW 8 85640544 missense probably damaging 1.00
R6083:Neto2 UTSW 8 85640585 missense probably benign 0.00
R6339:Neto2 UTSW 8 85640558 missense probably benign 0.33
R6381:Neto2 UTSW 8 85642509 missense probably damaging 0.99
R6572:Neto2 UTSW 8 85670404 missense possibly damaging 0.96
R6593:Neto2 UTSW 8 85669546 missense probably damaging 1.00
R6662:Neto2 UTSW 8 85663215 missense probably damaging 1.00
R6881:Neto2 UTSW 8 85640556 missense probably damaging 1.00
R6950:Neto2 UTSW 8 85670443 missense probably damaging 1.00
R7121:Neto2 UTSW 8 85670391 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGGTCATTGCAATATTCAAGAACAA -3'
(R):5'- AATGCTGGTGAGGACTGGT -3'

Sequencing Primer
(F):5'- GCTGTACAATGTGAGACTGCC -3'
(R):5'- AGGACTGGTGATTTTTAAGCCAAG -3'
Posted On2015-04-17