Incidental Mutation 'R3940:Rnf123'
ID307415
Institutional Source Beutler Lab
Gene Symbol Rnf123
Ensembl Gene ENSMUSG00000041528
Gene Namering finger protein 123
SynonymsKPC1
MMRRC Submission 040922-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R3940 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108051534-108083346 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 108064035 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000162355] [ENSMUST00000162753] [ENSMUST00000178267]
Predicted Effect probably benign
Transcript: ENSMUST00000047746
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159136
Predicted Effect probably benign
Transcript: ENSMUST00000159306
SMART Domains Protein: ENSMUSP00000125695
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
coiled coil region 172 192 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160249
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160649
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161673
Predicted Effect probably benign
Transcript: ENSMUST00000162355
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162753
Predicted Effect probably benign
Transcript: ENSMUST00000178267
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 95% (35/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Acsm3 A G 7: 119,773,886 E204G probably benign Het
Acta2 A T 19: 34,243,480 I276N possibly damaging Het
Ankrd16 T C 2: 11,784,381 C260R probably benign Het
Ankrd42 T C 7: 92,591,788 probably null Het
Atp13a2 T C 4: 141,006,422 S1041P probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Calm5 A T 13: 3,854,485 I37F possibly damaging Het
Casq1 A G 1: 172,219,536 V52A possibly damaging Het
Col22a1 A T 15: 71,981,933 L260* probably null Het
Cttnbp2 C A 6: 18,420,975 V846L probably benign Het
Dnah12 A G 14: 26,723,599 T627A probably benign Het
Eogt T C 6: 97,113,914 I421M probably damaging Het
Fam135a T A 1: 24,057,475 H63L probably damaging Het
Fmo3 T A 1: 162,963,986 T241S probably benign Het
Frem3 T C 8: 80,615,020 I1314T possibly damaging Het
Gm14393 T C 2: 175,061,627 probably null Het
Kcna5 C T 6: 126,533,651 V505I probably damaging Het
Kit A G 5: 75,609,318 D130G probably benign Het
Neto2 G A 8: 85,674,118 T16I probably damaging Het
Olfr1090 T A 2: 86,753,931 D269V possibly damaging Het
Olfr57 T A 10: 79,035,204 I136N probably damaging Het
Pcdhb7 T C 18: 37,343,968 L719P probably damaging Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pik3ip1 A G 11: 3,331,987 N48S probably damaging Het
Pkn2 G A 3: 142,793,911 S951L probably damaging Het
Prrc2a T C 17: 35,157,498 H772R possibly damaging Het
Ric1 T C 19: 29,570,762 Y277H probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Robo1 T C 16: 73,009,743 S1166P probably benign Het
S100a10 A G 3: 93,561,076 E38G probably benign Het
Slc34a1 A T 13: 55,413,170 I483F probably damaging Het
Stim1 A G 7: 102,435,641 N600S probably benign Het
Ube3c T A 5: 29,619,360 N517K probably benign Het
Other mutations in Rnf123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Rnf123 APN 9 108067395 critical splice donor site probably null
IGL01358:Rnf123 APN 9 108069182 missense probably damaging 1.00
IGL01464:Rnf123 APN 9 108052302 missense probably damaging 1.00
IGL01637:Rnf123 APN 9 108058238 missense probably damaging 1.00
IGL01669:Rnf123 APN 9 108058356 missense probably damaging 0.98
IGL01905:Rnf123 APN 9 108071370 splice site probably benign
IGL02070:Rnf123 APN 9 108068302 nonsense probably null
IGL02072:Rnf123 APN 9 108068302 nonsense probably null
IGL02073:Rnf123 APN 9 108068302 nonsense probably null
IGL02074:Rnf123 APN 9 108066889 missense probably damaging 1.00
IGL02079:Rnf123 APN 9 108068302 nonsense probably null
IGL02080:Rnf123 APN 9 108068302 nonsense probably null
IGL02231:Rnf123 APN 9 108066399 missense probably benign 0.17
IGL02281:Rnf123 APN 9 108071452 missense probably benign 0.01
IGL02336:Rnf123 APN 9 108061842 missense probably damaging 1.00
IGL02543:Rnf123 APN 9 108066348 missense probably damaging 1.00
IGL02565:Rnf123 APN 9 108052212 critical splice donor site probably null
IGL02571:Rnf123 APN 9 108068302 nonsense probably null
IGL02572:Rnf123 APN 9 108068302 nonsense probably null
IGL02574:Rnf123 APN 9 108068302 nonsense probably null
IGL02586:Rnf123 APN 9 108068302 nonsense probably null
IGL02589:Rnf123 APN 9 108068302 nonsense probably null
IGL02600:Rnf123 APN 9 108068302 nonsense probably null
IGL02601:Rnf123 APN 9 108068302 nonsense probably null
IGL02602:Rnf123 APN 9 108068302 nonsense probably null
IGL02603:Rnf123 APN 9 108068302 nonsense probably null
IGL02609:Rnf123 APN 9 108068302 nonsense probably null
IGL02628:Rnf123 APN 9 108068302 nonsense probably null
IGL02629:Rnf123 APN 9 108068302 nonsense probably null
IGL02629:Rnf123 APN 9 108070789 splice site probably benign
IGL02630:Rnf123 APN 9 108068302 nonsense probably null
IGL02631:Rnf123 APN 9 108068302 nonsense probably null
IGL02632:Rnf123 APN 9 108068302 nonsense probably null
IGL02650:Rnf123 APN 9 108069748 missense probably benign 0.29
IGL02690:Rnf123 APN 9 108068302 nonsense probably null
IGL02691:Rnf123 APN 9 108068302 nonsense probably null
IGL02692:Rnf123 APN 9 108068302 nonsense probably null
IGL02693:Rnf123 APN 9 108068302 nonsense probably null
IGL02713:Rnf123 APN 9 108068302 nonsense probably null
IGL02736:Rnf123 APN 9 108068302 nonsense probably null
IGL02929:Rnf123 APN 9 108069076 missense probably benign
R1175:Rnf123 UTSW 9 108077373 missense probably benign
R1465:Rnf123 UTSW 9 108071466 splice site probably benign
R1502:Rnf123 UTSW 9 108068510 unclassified probably null
R1682:Rnf123 UTSW 9 108077398 missense probably benign 0.16
R1817:Rnf123 UTSW 9 108062926 missense probably benign 0.41
R1855:Rnf123 UTSW 9 108061791 missense probably damaging 1.00
R2394:Rnf123 UTSW 9 108063536 missense probably benign 0.00
R2483:Rnf123 UTSW 9 108063521 missense probably benign 0.16
R3896:Rnf123 UTSW 9 108069103 splice site probably benign
R4206:Rnf123 UTSW 9 108063963 missense probably benign 0.01
R4641:Rnf123 UTSW 9 108058587 missense probably damaging 1.00
R4714:Rnf123 UTSW 9 108052439 splice site probably null
R4767:Rnf123 UTSW 9 108052089 missense probably damaging 1.00
R4849:Rnf123 UTSW 9 108056091 missense probably damaging 1.00
R4899:Rnf123 UTSW 9 108063680 missense probably damaging 1.00
R5274:Rnf123 UTSW 9 108064003 frame shift probably null
R5275:Rnf123 UTSW 9 108064003 frame shift probably null
R5276:Rnf123 UTSW 9 108064003 frame shift probably null
R5294:Rnf123 UTSW 9 108064003 frame shift probably null
R5295:Rnf123 UTSW 9 108064003 frame shift probably null
R5394:Rnf123 UTSW 9 108070731 missense probably damaging 1.00
R5717:Rnf123 UTSW 9 108067424 missense probably damaging 1.00
R6186:Rnf123 UTSW 9 108069958 missense possibly damaging 0.55
R6449:Rnf123 UTSW 9 108056053 missense probably benign 0.17
R6502:Rnf123 UTSW 9 108068332 missense possibly damaging 0.46
R6944:Rnf123 UTSW 9 108063623 missense probably benign 0.02
R7003:Rnf123 UTSW 9 108063683 critical splice acceptor site probably null
R7088:Rnf123 UTSW 9 108058536 missense probably null 1.00
R7092:Rnf123 UTSW 9 108068600 missense probably benign 0.07
R7100:Rnf123 UTSW 9 108056639 missense probably damaging 1.00
R7257:Rnf123 UTSW 9 108069029 missense probably damaging 1.00
R7468:Rnf123 UTSW 9 108069009 missense probably benign 0.00
R7517:Rnf123 UTSW 9 108070274 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTGCCTACACGGAGAGAAG -3'
(R):5'- CCTCCTGCTGCTAGTTGTAG -3'

Sequencing Primer
(F):5'- AAGCCGGACCTGGGTCATAC -3'
(R):5'- AGGGGCCCTCTGAGATGTAGAC -3'
Posted On2015-04-17