Incidental Mutation 'R3940:Slc34a1'
ID307418
Institutional Source Beutler Lab
Gene Symbol Slc34a1
Ensembl Gene ENSMUSG00000021490
Gene Namesolute carrier family 34 (sodium phosphate), member 1
SynonymsNa/Pi cotransporter, Npt2, NaPi-IIa, Slc17a2, renal Na+/Pi transporter
MMRRC Submission 040922-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R3940 (G1)
Quality Score145
Status Validated
Chromosome13
Chromosomal Location55398187-55415592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55413170 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 483 (I483F)
Ref Sequence ENSEMBL: ENSMUSP00000153038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021948] [ENSMUST00000054146] [ENSMUST00000057167] [ENSMUST00000170921] [ENSMUST00000224925] [ENSMUST00000225259]
Predicted Effect probably benign
Transcript: ENSMUST00000021948
SMART Domains Protein: ENSMUSP00000021948
Gene: ENSMUSG00000021492

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
FN2 40 88 4.3e-24 SMART
EGF 97 131 4.22e-4 SMART
FN1 135 175 2.4e-13 SMART
EGF 177 210 3.94e-4 SMART
KR 215 297 6.88e-27 SMART
low complexity region 302 320 N/A INTRINSIC
Tryp_SPc 354 591 7.74e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054146
SMART Domains Protein: ENSMUSP00000054053
Gene: ENSMUSG00000044444

DomainStartEndE-ValueType
Pfam:Profilin 3 132 7.5e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000057167
AA Change: I483F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059138
Gene: ENSMUSG00000021490
AA Change: I483F

DomainStartEndE-ValueType
Pfam:Na_Pi_cotrans 113 256 7.4e-28 PFAM
Pfam:Na_Pi_cotrans 359 549 2.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170921
SMART Domains Protein: ENSMUSP00000125771
Gene: ENSMUSG00000021492

DomainStartEndE-ValueType
Tryp_SPc 2 137 3.4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224043
Predicted Effect probably benign
Transcript: ENSMUST00000224925
Predicted Effect probably damaging
Transcript: ENSMUST00000225259
AA Change: I483F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225538
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 95% (35/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II sodium-phosphate cotransporter family. Mutations in this gene are associated with hypophosphatemia nephrolithiasis/osteoporosis 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous null mice exhibit renal phosphate wasting, hyerpcalciuria, and skeletal abnormalities. Postnatal viability is reduced, putatively due to poor nutritional status. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Acsm3 A G 7: 119,773,886 E204G probably benign Het
Acta2 A T 19: 34,243,480 I276N possibly damaging Het
Ankrd16 T C 2: 11,784,381 C260R probably benign Het
Ankrd42 T C 7: 92,591,788 probably null Het
Atp13a2 T C 4: 141,006,422 S1041P probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Calm5 A T 13: 3,854,485 I37F possibly damaging Het
Casq1 A G 1: 172,219,536 V52A possibly damaging Het
Col22a1 A T 15: 71,981,933 L260* probably null Het
Cttnbp2 C A 6: 18,420,975 V846L probably benign Het
Dnah12 A G 14: 26,723,599 T627A probably benign Het
Eogt T C 6: 97,113,914 I421M probably damaging Het
Fam135a T A 1: 24,057,475 H63L probably damaging Het
Fmo3 T A 1: 162,963,986 T241S probably benign Het
Frem3 T C 8: 80,615,020 I1314T possibly damaging Het
Gm14393 T C 2: 175,061,627 probably null Het
Kcna5 C T 6: 126,533,651 V505I probably damaging Het
Kit A G 5: 75,609,318 D130G probably benign Het
Neto2 G A 8: 85,674,118 T16I probably damaging Het
Olfr1090 T A 2: 86,753,931 D269V possibly damaging Het
Olfr57 T A 10: 79,035,204 I136N probably damaging Het
Pcdhb7 T C 18: 37,343,968 L719P probably damaging Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pik3ip1 A G 11: 3,331,987 N48S probably damaging Het
Pkn2 G A 3: 142,793,911 S951L probably damaging Het
Prrc2a T C 17: 35,157,498 H772R possibly damaging Het
Ric1 T C 19: 29,570,762 Y277H probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf123 A T 9: 108,064,035 probably benign Het
Robo1 T C 16: 73,009,743 S1166P probably benign Het
S100a10 A G 3: 93,561,076 E38G probably benign Het
Stim1 A G 7: 102,435,641 N600S probably benign Het
Ube3c T A 5: 29,619,360 N517K probably benign Het
Other mutations in Slc34a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Slc34a1 APN 13 55409071 missense probably damaging 1.00
IGL01396:Slc34a1 APN 13 55402733 missense probably damaging 1.00
IGL01405:Slc34a1 APN 13 55412128 missense probably damaging 1.00
IGL02525:Slc34a1 APN 13 55403238 splice site probably benign
IGL02555:Slc34a1 APN 13 55401168 missense possibly damaging 0.77
IGL02692:Slc34a1 APN 13 55403236 splice site probably benign
IGL03173:Slc34a1 APN 13 55413276 missense probably damaging 0.99
IGL03221:Slc34a1 APN 13 55400778 missense probably benign 0.00
R0190:Slc34a1 UTSW 13 55409101 missense probably benign 0.00
R0196:Slc34a1 UTSW 13 55412265 missense probably damaging 0.99
R0362:Slc34a1 UTSW 13 55402898 splice site probably null
R1055:Slc34a1 UTSW 13 55403033 missense probably benign 0.26
R1243:Slc34a1 UTSW 13 55412131 missense possibly damaging 0.85
R1414:Slc34a1 UTSW 13 55400711 missense probably benign
R1566:Slc34a1 UTSW 13 55412031 critical splice acceptor site probably null
R1732:Slc34a1 UTSW 13 55413420 missense probably benign
R1901:Slc34a1 UTSW 13 55401150 nonsense probably null
R2423:Slc34a1 UTSW 13 55409052 missense possibly damaging 0.63
R2986:Slc34a1 UTSW 13 55403329 missense probably benign 0.00
R4003:Slc34a1 UTSW 13 55402661 splice site probably benign
R4553:Slc34a1 UTSW 13 55412061 synonymous probably null
R4735:Slc34a1 UTSW 13 55413584 missense probably benign 0.13
R5177:Slc34a1 UTSW 13 55401162 missense probably damaging 0.99
R5345:Slc34a1 UTSW 13 55400518 missense probably benign
R5363:Slc34a1 UTSW 13 55403268 missense probably benign 0.16
R5363:Slc34a1 UTSW 13 55412290 missense probably damaging 1.00
R5668:Slc34a1 UTSW 13 55409085 missense possibly damaging 0.94
R5685:Slc34a1 UTSW 13 55401272 critical splice donor site probably null
R5782:Slc34a1 UTSW 13 55402688 missense possibly damaging 0.92
R5836:Slc34a1 UTSW 13 55413465 missense probably benign 0.05
R6047:Slc34a1 UTSW 13 55412071 missense probably damaging 1.00
R6496:Slc34a1 UTSW 13 55402682 missense probably benign 0.15
R7158:Slc34a1 UTSW 13 55401231 missense probably damaging 0.99
R7384:Slc34a1 UTSW 13 55402934 missense probably benign 0.00
X0022:Slc34a1 UTSW 13 55403015 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTCTGGTGTCATCTGGAGC -3'
(R):5'- CGGCTCTGCAGGACATTAAC -3'

Sequencing Primer
(F):5'- TGTCATCTGGAGCCACATCAG -3'
(R):5'- GCTCTGCAGGACATTAACAAGCAC -3'
Posted On2015-04-17