Incidental Mutation 'R0376:Cyp3a11'
ID30744
Institutional Source Beutler Lab
Gene Symbol Cyp3a11
Ensembl Gene ENSMUSG00000056035
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 11
SynonymsIIIAm1, Cyp3a, Pcn
MMRRC Submission 038582-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R0376 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location145854426-145879964 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to C at 145862452 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 308 (Y308*)
Ref Sequence ENSEMBL: ENSMUSP00000037665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035918]
Predicted Effect probably null
Transcript: ENSMUST00000035918
AA Change: Y308*
SMART Domains Protein: ENSMUSP00000037665
Gene: ENSMUSG00000056035
AA Change: Y308*

DomainStartEndE-ValueType
Pfam:p450 38 494 2.4e-136 PFAM
Meta Mutation Damage Score 0.622 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.0%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik G A 2: 173,528,327 E132K probably benign Het
Adam6a T C 12: 113,544,690 Y228H probably damaging Het
Als2 A G 1: 59,215,565 F211S probably benign Het
Ankrd12 T A 17: 66,053,009 Q11L probably damaging Het
Anxa5 T C 3: 36,460,488 R115G probably damaging Het
Arhgap10 T C 8: 77,450,824 probably benign Het
Atp2a3 T A 11: 72,982,702 D782E probably damaging Het
Bcr G T 10: 75,145,327 L659F probably damaging Het
Cacna1b A G 2: 24,659,003 probably benign Het
Camp C T 9: 109,848,399 C122Y probably damaging Het
Col12a1 A T 9: 79,693,494 S769R probably benign Het
Cyp2j6 T A 4: 96,526,023 K335I probably damaging Het
Flnb G A 14: 7,946,014 probably null Het
Frmd4a G T 2: 4,572,387 M351I probably damaging Het
Gabrg2 C T 11: 41,916,315 S365N possibly damaging Het
Ggn T C 7: 29,173,022 V609A possibly damaging Het
H60c T C 10: 3,260,435 probably benign Het
Hexdc T A 11: 121,218,165 probably benign Het
Igsf9b A G 9: 27,334,582 T1282A probably benign Het
Ikzf4 T C 10: 128,632,756 N618S probably benign Het
Ints14 A G 9: 64,983,990 K418E probably damaging Het
Iqgap1 T C 7: 80,723,879 E1454G probably benign Het
Kif13b T C 14: 64,757,404 probably benign Het
Krt71 A C 15: 101,738,070 F328C probably damaging Het
Lama2 T C 10: 27,015,546 T2524A possibly damaging Het
Mfn2 C T 4: 147,885,526 V363I probably benign Het
Mkln1 A T 6: 31,478,018 D496V probably benign Het
Olfr450 A T 6: 42,818,292 M274L probably benign Het
Patj T A 4: 98,568,987 I1242N probably damaging Het
Pcnx C T 12: 81,974,579 probably benign Het
Plcb2 T C 2: 118,717,240 E502G probably damaging Het
Plppr4 G T 3: 117,323,091 H314Q probably benign Het
Prkcsh A G 9: 22,010,251 probably benign Het
Prr14 C T 7: 127,476,643 H181Y probably benign Het
Pus3 A T 9: 35,566,422 M317L possibly damaging Het
Pwwp2a T A 11: 43,704,672 D221E probably benign Het
Rbm15 T C 3: 107,330,938 S715G probably benign Het
Rbm28 A G 6: 29,158,928 probably benign Het
Rhobtb2 A T 14: 69,796,735 V347E probably benign Het
Rimbp2 C T 5: 128,803,861 R161Q probably damaging Het
Scgb1b27 C T 7: 34,021,897 T70I possibly damaging Het
Slc40a1 T C 1: 45,912,491 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spaca9 A G 2: 28,693,660 V104A probably benign Het
Spag7 T C 11: 70,669,190 probably benign Het
Sugp1 A G 8: 70,052,638 D85G probably damaging Het
Sun1 A G 5: 139,226,699 probably benign Het
Tcp11l1 C A 2: 104,697,505 probably benign Het
Tead3 A C 17: 28,341,365 D88E probably damaging Het
Tecpr1 A T 5: 144,207,476 V636E possibly damaging Het
Tldc2 T C 2: 157,095,305 W147R probably damaging Het
Tmem161b A G 13: 84,292,383 T125A probably benign Het
Trrap A G 5: 144,816,339 M1825V probably benign Het
Ttbk2 A G 2: 120,777,581 F186L probably damaging Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Zc3h7a T C 16: 11,156,202 M240V probably benign Het
Zc3hc1 G C 6: 30,372,790 S351W probably damaging Het
Zfp366 T C 13: 99,234,251 M493T probably benign Het
Zfp93 C T 7: 24,275,861 P424S probably damaging Het
Other mutations in Cyp3a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Cyp3a11 APN 5 145862465 missense probably damaging 1.00
IGL01316:Cyp3a11 APN 5 145855151 missense possibly damaging 0.78
IGL01348:Cyp3a11 APN 5 145869007 missense possibly damaging 0.80
IGL01591:Cyp3a11 APN 5 145875481 splice site probably benign
IGL01665:Cyp3a11 APN 5 145868665 missense probably benign 0.00
IGL02203:Cyp3a11 APN 5 145869166 missense probably damaging 1.00
IGL02894:Cyp3a11 APN 5 145869026 nonsense probably null
IGL03201:Cyp3a11 APN 5 145860379 missense possibly damaging 0.94
IGL03342:Cyp3a11 APN 5 145855117 missense probably damaging 0.96
PIT4486001:Cyp3a11 UTSW 5 145860492 missense probably damaging 0.99
R0347:Cyp3a11 UTSW 5 145865925 missense possibly damaging 0.93
R0378:Cyp3a11 UTSW 5 145868607 missense probably benign 0.43
R0448:Cyp3a11 UTSW 5 145862394 missense probably benign 0.00
R0567:Cyp3a11 UTSW 5 145869149 missense probably damaging 1.00
R0968:Cyp3a11 UTSW 5 145862514 splice site probably benign
R1292:Cyp3a11 UTSW 5 145865994 missense probably benign 0.04
R1400:Cyp3a11 UTSW 5 145862489 missense probably damaging 0.98
R1478:Cyp3a11 UTSW 5 145858771 missense probably benign 0.01
R1520:Cyp3a11 UTSW 5 145862453 missense probably damaging 1.00
R1716:Cyp3a11 UTSW 5 145868966 missense probably benign
R2060:Cyp3a11 UTSW 5 145855081 missense probably benign 0.00
R2076:Cyp3a11 UTSW 5 145879766 missense probably benign
R2227:Cyp3a11 UTSW 5 145868547 missense possibly damaging 0.90
R3725:Cyp3a11 UTSW 5 145866000 missense probably benign 0.02
R4222:Cyp3a11 UTSW 5 145860466 missense probably damaging 0.99
R4256:Cyp3a11 UTSW 5 145869195 missense probably benign 0.04
R4294:Cyp3a11 UTSW 5 145869195 missense probably benign 0.04
R4852:Cyp3a11 UTSW 5 145860495 missense probably damaging 1.00
R5229:Cyp3a11 UTSW 5 145855135 missense probably benign 0.00
R5285:Cyp3a11 UTSW 5 145855083 missense probably benign 0.00
R5590:Cyp3a11 UTSW 5 145865977 missense probably benign 0.00
R5703:Cyp3a11 UTSW 5 145860373 missense probably benign
R5786:Cyp3a11 UTSW 5 145862474 missense possibly damaging 0.47
R6291:Cyp3a11 UTSW 5 145862427 missense possibly damaging 0.89
R6405:Cyp3a11 UTSW 5 145862420 missense probably damaging 0.96
R6892:Cyp3a11 UTSW 5 145860448 missense probably damaging 0.98
R7114:Cyp3a11 UTSW 5 145858783 missense probably benign 0.16
R7243:Cyp3a11 UTSW 5 145858803 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CACCATTGCAAGTGACCAAACTGTG -3'
(R):5'- GGACAATCTGCCTGAAGCCTTCTC -3'

Sequencing Primer
(F):5'- ACCAAACTGTGTCTTTGTTGAG -3'
(R):5'- TCTCAGTGTGACTGAACAGC -3'
Posted On2013-04-24