Incidental Mutation 'R3941:Nipal4'
ID307459
Institutional Source Beutler Lab
Gene Symbol Nipal4
Ensembl Gene ENSMUSG00000020411
Gene NameNIPA-like domain containing 4
Synonyms
MMRRC Submission 040923-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R3941 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location46148155-46166508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46150646 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 241 (V241M)
Ref Sequence ENSEMBL: ENSMUSP00000020679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011400] [ENSMUST00000020679]
Predicted Effect probably benign
Transcript: ENSMUST00000011400
SMART Domains Protein: ENSMUSP00000011400
Gene: ENSMUSG00000011256

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Pep_M12B_propep 32 163 9.4e-27 PFAM
Pfam:Reprolysin_5 209 388 1.9e-25 PFAM
Pfam:Reprolysin_4 209 399 1.5e-15 PFAM
Pfam:Reprolysin 211 409 1.3e-68 PFAM
Pfam:Reprolysin_2 231 399 6.1e-19 PFAM
Pfam:Reprolysin_3 235 357 1.2e-19 PFAM
DISIN 426 501 9.7e-41 SMART
ACR 502 650 7.46e-62 SMART
transmembrane domain 704 726 N/A INTRINSIC
low complexity region 788 797 N/A INTRINSIC
low complexity region 832 846 N/A INTRINSIC
low complexity region 886 905 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000020679
AA Change: V241M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020679
Gene: ENSMUSG00000020411
AA Change: V241M

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 56 350 1.6e-122 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144915
Meta Mutation Damage Score 0.25 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a membrane receptor. Mutations in this gene have been associated with autosomal recessive congenital ichthyosis. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610203C20Rik T C 9: 41,590,274 L143P probably damaging Het
Abcc1 A T 16: 14,396,399 T193S probably benign Het
Arhgap11a A T 2: 113,836,897 L435Q probably damaging Het
Bin1 T C 18: 32,406,158 V48A probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Btn1a1 T G 13: 23,459,264 R338S probably benign Het
Cacnb4 C A 2: 52,469,489 R169L probably damaging Het
Ccdc80 A G 16: 45,096,092 T404A probably benign Het
Cd2ap G C 17: 42,808,799 H488D probably damaging Het
Cdon A G 9: 35,464,171 T498A probably benign Het
Cngb3 A G 4: 19,396,786 N380D probably benign Het
Col6a5 G A 9: 105,939,834 S426F unknown Het
Cr2 A T 1: 195,165,814 H345Q probably damaging Het
Cttnbp2 T A 6: 18,427,453 K743M probably benign Het
Depdc1b T C 13: 108,368,836 S245P probably damaging Het
Dync2h1 G A 9: 7,124,825 H2016Y probably benign Het
Eif2s3y G T Y: 1,012,079 R98L probably benign Het
Eml6 C T 11: 29,803,167 G915S probably damaging Het
Fcgr1 A G 3: 96,286,033 L216P probably benign Het
Fpr-rs3 T C 17: 20,624,849 N10S probably benign Het
Frem3 T C 8: 80,615,020 I1314T possibly damaging Het
Gabrr3 A G 16: 59,433,501 N194D probably damaging Het
Hey1 A G 3: 8,664,578 L273P probably damaging Het
Irf6 A G 1: 193,168,549 K365E probably benign Het
Kit A G 5: 75,609,318 D130G probably benign Het
Lrp1 G A 10: 127,553,396 A3217V probably damaging Het
Mei4 C T 9: 81,927,283 R140C probably benign Het
Mpo A T 11: 87,797,349 K278M probably benign Het
Mprip T C 11: 59,731,502 probably benign Het
Mug2 G C 6: 122,063,563 G691R probably benign Het
Neto2 G A 8: 85,674,118 T16I probably damaging Het
Nlrp2 A T 7: 5,327,552 L615* probably null Het
Pcdh1 A G 18: 38,199,458 V164A probably benign Het
Phc2 T C 4: 128,747,244 probably null Het
Plekhg3 A G 12: 76,573,359 E623G probably damaging Het
Psors1c2 G T 17: 35,533,928 G29* probably null Het
Slc25a54 A T 3: 109,112,163 D361V probably damaging Het
Slc39a12 A T 2: 14,396,181 H123L possibly damaging Het
Sorl1 T C 9: 41,989,468 probably null Het
Strn A T 17: 78,657,940 I641N probably damaging Het
Tapbp A G 17: 33,920,483 E151G possibly damaging Het
Ticrr T C 7: 79,693,697 probably benign Het
Tnfrsf21 G A 17: 43,038,010 C171Y probably damaging Het
Ttyh1 T A 7: 4,129,318 L155H probably damaging Het
Utrn T A 10: 12,711,585 probably null Het
Vmn1r175 A G 7: 23,808,968 V78A probably benign Het
Vmn1r73 T C 7: 11,756,755 Y167H probably damaging Het
Washc1 T C 17: 66,118,128 S376P probably damaging Het
Wnt10a T A 1: 74,803,497 probably null Het
Xrcc4 A G 13: 90,071,633 V16A probably benign Het
Zeb1 T C 18: 5,767,799 V770A probably benign Het
Zfp410 A G 12: 84,338,753 N90S probably damaging Het
Other mutations in Nipal4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02531:Nipal4 APN 11 46151325 missense probably damaging 1.00
IGL03203:Nipal4 APN 11 46150296 missense probably damaging 1.00
H8786:Nipal4 UTSW 11 46150477 missense probably damaging 1.00
R0239:Nipal4 UTSW 11 46150441 missense possibly damaging 0.80
R0239:Nipal4 UTSW 11 46150441 missense possibly damaging 0.80
R0331:Nipal4 UTSW 11 46150213 missense probably damaging 1.00
R0414:Nipal4 UTSW 11 46161908 missense probably damaging 1.00
R0613:Nipal4 UTSW 11 46150384 missense probably benign 0.31
R0940:Nipal4 UTSW 11 46150312 missense possibly damaging 0.48
R1797:Nipal4 UTSW 11 46151333 missense probably benign 0.06
R1889:Nipal4 UTSW 11 46150733 missense probably damaging 0.99
R1899:Nipal4 UTSW 11 46150231 missense probably damaging 1.00
R1974:Nipal4 UTSW 11 46151383 missense probably damaging 1.00
R2066:Nipal4 UTSW 11 46156795 missense probably damaging 1.00
R3705:Nipal4 UTSW 11 46161851 splice site probably benign
R4597:Nipal4 UTSW 11 46151329 missense probably damaging 1.00
R4965:Nipal4 UTSW 11 46162010 missense possibly damaging 0.68
R5888:Nipal4 UTSW 11 46151339 missense probably damaging 0.98
R6533:Nipal4 UTSW 11 46150407 nonsense probably null
X0018:Nipal4 UTSW 11 46162046 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGTATACCACTCCTTGAAGAGGAC -3'
(R):5'- CCCTTGAGTCCTTTGCTGAATAAC -3'

Sequencing Primer
(F):5'- ATGGAGGAGGCCACCAC -3'
(R):5'- GAGTCCTTTGCTGAATAACTTTTACC -3'
Posted On2015-04-17