Incidental Mutation 'R3941:Plekhg3'
ID307461
Institutional Source Beutler Lab
Gene Symbol Plekhg3
Ensembl Gene ENSMUSG00000052609
Gene Namepleckstrin homology domain containing, family G (with RhoGef domain) member 3
SynonymsMGC40768
MMRRC Submission 040923-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3941 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location76530891-76580488 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76573359 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 623 (E623G)
Ref Sequence ENSEMBL: ENSMUSP00000151851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075249] [ENSMUST00000219063]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075249
AA Change: E624G

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074729
Gene: ENSMUSG00000052609
AA Change: E624G

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
RhoGEF 97 271 6.67e-51 SMART
PH 297 396 2.48e-9 SMART
coiled coil region 515 552 N/A INTRINSIC
low complexity region 563 585 N/A INTRINSIC
low complexity region 696 710 N/A INTRINSIC
low complexity region 727 737 N/A INTRINSIC
low complexity region 753 766 N/A INTRINSIC
low complexity region 978 993 N/A INTRINSIC
low complexity region 1233 1246 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218427
Predicted Effect probably damaging
Transcript: ENSMUST00000219063
AA Change: E623G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219426
Meta Mutation Damage Score 0.23 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610203C20Rik T C 9: 41,590,274 L143P probably damaging Het
Abcc1 A T 16: 14,396,399 T193S probably benign Het
Arhgap11a A T 2: 113,836,897 L435Q probably damaging Het
Bin1 T C 18: 32,406,158 V48A probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Btn1a1 T G 13: 23,459,264 R338S probably benign Het
Cacnb4 C A 2: 52,469,489 R169L probably damaging Het
Ccdc80 A G 16: 45,096,092 T404A probably benign Het
Cd2ap G C 17: 42,808,799 H488D probably damaging Het
Cdon A G 9: 35,464,171 T498A probably benign Het
Cngb3 A G 4: 19,396,786 N380D probably benign Het
Col6a5 G A 9: 105,939,834 S426F unknown Het
Cr2 A T 1: 195,165,814 H345Q probably damaging Het
Cttnbp2 T A 6: 18,427,453 K743M probably benign Het
Depdc1b T C 13: 108,368,836 S245P probably damaging Het
Dync2h1 G A 9: 7,124,825 H2016Y probably benign Het
Eif2s3y G T Y: 1,012,079 R98L probably benign Het
Eml6 C T 11: 29,803,167 G915S probably damaging Het
Fcgr1 A G 3: 96,286,033 L216P probably benign Het
Fpr-rs3 T C 17: 20,624,849 N10S probably benign Het
Frem3 T C 8: 80,615,020 I1314T possibly damaging Het
Gabrr3 A G 16: 59,433,501 N194D probably damaging Het
Hey1 A G 3: 8,664,578 L273P probably damaging Het
Irf6 A G 1: 193,168,549 K365E probably benign Het
Kit A G 5: 75,609,318 D130G probably benign Het
Lrp1 G A 10: 127,553,396 A3217V probably damaging Het
Mei4 C T 9: 81,927,283 R140C probably benign Het
Mpo A T 11: 87,797,349 K278M probably benign Het
Mprip T C 11: 59,731,502 probably benign Het
Mug2 G C 6: 122,063,563 G691R probably benign Het
Neto2 G A 8: 85,674,118 T16I probably damaging Het
Nipal4 C T 11: 46,150,646 V241M probably damaging Het
Nlrp2 A T 7: 5,327,552 L615* probably null Het
Pcdh1 A G 18: 38,199,458 V164A probably benign Het
Phc2 T C 4: 128,747,244 probably null Het
Psors1c2 G T 17: 35,533,928 G29* probably null Het
Slc25a54 A T 3: 109,112,163 D361V probably damaging Het
Slc39a12 A T 2: 14,396,181 H123L possibly damaging Het
Sorl1 T C 9: 41,989,468 probably null Het
Strn A T 17: 78,657,940 I641N probably damaging Het
Tapbp A G 17: 33,920,483 E151G possibly damaging Het
Ticrr T C 7: 79,693,697 probably benign Het
Tnfrsf21 G A 17: 43,038,010 C171Y probably damaging Het
Ttyh1 T A 7: 4,129,318 L155H probably damaging Het
Utrn T A 10: 12,711,585 probably null Het
Vmn1r175 A G 7: 23,808,968 V78A probably benign Het
Vmn1r73 T C 7: 11,756,755 Y167H probably damaging Het
Washc1 T C 17: 66,118,128 S376P probably damaging Het
Wnt10a T A 1: 74,803,497 probably null Het
Xrcc4 A G 13: 90,071,633 V16A probably benign Het
Zeb1 T C 18: 5,767,799 V770A probably benign Het
Zfp410 A G 12: 84,338,753 N90S probably damaging Het
Other mutations in Plekhg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01079:Plekhg3 APN 12 76562278 missense probably damaging 0.99
IGL01143:Plekhg3 APN 12 76564982 critical splice donor site probably null
IGL02079:Plekhg3 APN 12 76560429 missense probably benign 0.01
IGL02349:Plekhg3 APN 12 76562300 missense probably damaging 1.00
IGL02442:Plekhg3 APN 12 76578353 missense probably benign 0.01
IGL02570:Plekhg3 APN 12 76578245 missense probably benign
flagging UTSW 12 76560520 critical splice donor site probably null
trailing UTSW 12 76564961 missense probably benign 0.15
R0344:Plekhg3 UTSW 12 76566266 nonsense probably null
R0667:Plekhg3 UTSW 12 76576598 missense probably damaging 1.00
R1269:Plekhg3 UTSW 12 76560469 missense probably damaging 1.00
R1566:Plekhg3 UTSW 12 76572065 missense possibly damaging 0.54
R1905:Plekhg3 UTSW 12 76576217 missense probably benign 0.05
R2885:Plekhg3 UTSW 12 76564961 missense probably benign 0.15
R2962:Plekhg3 UTSW 12 76572659 critical splice donor site probably null
R3784:Plekhg3 UTSW 12 76560520 critical splice donor site probably null
R4056:Plekhg3 UTSW 12 76565247 missense probably damaging 1.00
R4080:Plekhg3 UTSW 12 76577981 missense probably benign 0.02
R4412:Plekhg3 UTSW 12 76577764 missense probably damaging 0.96
R4413:Plekhg3 UTSW 12 76577764 missense probably damaging 0.96
R4704:Plekhg3 UTSW 12 76578238 missense probably damaging 1.00
R4720:Plekhg3 UTSW 12 76578322 missense possibly damaging 0.59
R4738:Plekhg3 UTSW 12 76576914 missense probably damaging 1.00
R4898:Plekhg3 UTSW 12 76564125 missense probably damaging 1.00
R4994:Plekhg3 UTSW 12 76565537 missense possibly damaging 0.68
R4999:Plekhg3 UTSW 12 76565247 missense possibly damaging 0.95
R5484:Plekhg3 UTSW 12 76578400 missense possibly damaging 0.76
R5591:Plekhg3 UTSW 12 76560292 missense possibly damaging 0.80
R6019:Plekhg3 UTSW 12 76577941 nonsense probably null
R6147:Plekhg3 UTSW 12 76565211 missense probably damaging 0.96
R6272:Plekhg3 UTSW 12 76576845 missense probably benign 0.00
R6482:Plekhg3 UTSW 12 76576004 missense probably benign 0.01
R7081:Plekhg3 UTSW 12 76578245 missense probably benign
X0062:Plekhg3 UTSW 12 76573343 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ATTTGGAAGGGCTTGGGCAC -3'
(R):5'- GACTGTTTGCCAAACCACAC -3'

Sequencing Primer
(F):5'- ATACGGGAGGCACTGTCCATG -3'
(R):5'- ACACCTCTAGGCTGTCCAG -3'
Posted On2015-04-17