Incidental Mutation 'R0376:Olfr450'
ID30748
Institutional Source Beutler Lab
Gene Symbol Olfr450
Ensembl Gene ENSMUSG00000054431
Gene Nameolfactory receptor 450
SynonymsMOR257-3, GA_x6K02T2P3E9-4742413-4741481
MMRRC Submission 038582-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R0376 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location42811939-42819081 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42818292 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 274 (M274L)
Ref Sequence ENSEMBL: ENSMUSP00000151908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067503] [ENSMUST00000218832]
Predicted Effect probably benign
Transcript: ENSMUST00000067503
AA Change: M274L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000068823
Gene: ENSMUSG00000054431
AA Change: M274L

DomainStartEndE-ValueType
Pfam:7tm_4 33 308 8.2e-49 PFAM
Pfam:7tm_1 43 291 1.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218832
AA Change: M274L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.1116 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.0%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik G A 2: 173,528,327 E132K probably benign Het
Adam6a T C 12: 113,544,690 Y228H probably damaging Het
Als2 A G 1: 59,215,565 F211S probably benign Het
Ankrd12 T A 17: 66,053,009 Q11L probably damaging Het
Anxa5 T C 3: 36,460,488 R115G probably damaging Het
Arhgap10 T C 8: 77,450,824 probably benign Het
Atp2a3 T A 11: 72,982,702 D782E probably damaging Het
Bcr G T 10: 75,145,327 L659F probably damaging Het
Cacna1b A G 2: 24,659,003 probably benign Het
Camp C T 9: 109,848,399 C122Y probably damaging Het
Col12a1 A T 9: 79,693,494 S769R probably benign Het
Cyp2j6 T A 4: 96,526,023 K335I probably damaging Het
Cyp3a11 A C 5: 145,862,452 Y308* probably null Het
Flnb G A 14: 7,946,014 probably null Het
Frmd4a G T 2: 4,572,387 M351I probably damaging Het
Gabrg2 C T 11: 41,916,315 S365N possibly damaging Het
Ggn T C 7: 29,173,022 V609A possibly damaging Het
H60c T C 10: 3,260,435 probably benign Het
Hexdc T A 11: 121,218,165 probably benign Het
Igsf9b A G 9: 27,334,582 T1282A probably benign Het
Ikzf4 T C 10: 128,632,756 N618S probably benign Het
Ints14 A G 9: 64,983,990 K418E probably damaging Het
Iqgap1 T C 7: 80,723,879 E1454G probably benign Het
Kif13b T C 14: 64,757,404 probably benign Het
Krt71 A C 15: 101,738,070 F328C probably damaging Het
Lama2 T C 10: 27,015,546 T2524A possibly damaging Het
Mfn2 C T 4: 147,885,526 V363I probably benign Het
Mkln1 A T 6: 31,478,018 D496V probably benign Het
Patj T A 4: 98,568,987 I1242N probably damaging Het
Pcnx C T 12: 81,974,579 probably benign Het
Plcb2 T C 2: 118,717,240 E502G probably damaging Het
Plppr4 G T 3: 117,323,091 H314Q probably benign Het
Prkcsh A G 9: 22,010,251 probably benign Het
Prr14 C T 7: 127,476,643 H181Y probably benign Het
Pus3 A T 9: 35,566,422 M317L possibly damaging Het
Pwwp2a T A 11: 43,704,672 D221E probably benign Het
Rbm15 T C 3: 107,330,938 S715G probably benign Het
Rbm28 A G 6: 29,158,928 probably benign Het
Rhobtb2 A T 14: 69,796,735 V347E probably benign Het
Rimbp2 C T 5: 128,803,861 R161Q probably damaging Het
Scgb1b27 C T 7: 34,021,897 T70I possibly damaging Het
Slc40a1 T C 1: 45,912,491 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spaca9 A G 2: 28,693,660 V104A probably benign Het
Spag7 T C 11: 70,669,190 probably benign Het
Sugp1 A G 8: 70,052,638 D85G probably damaging Het
Sun1 A G 5: 139,226,699 probably benign Het
Tcp11l1 C A 2: 104,697,505 probably benign Het
Tead3 A C 17: 28,341,365 D88E probably damaging Het
Tecpr1 A T 5: 144,207,476 V636E possibly damaging Het
Tldc2 T C 2: 157,095,305 W147R probably damaging Het
Tmem161b A G 13: 84,292,383 T125A probably benign Het
Trrap A G 5: 144,816,339 M1825V probably benign Het
Ttbk2 A G 2: 120,777,581 F186L probably damaging Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Zc3h7a T C 16: 11,156,202 M240V probably benign Het
Zc3hc1 G C 6: 30,372,790 S351W probably damaging Het
Zfp366 T C 13: 99,234,251 M493T probably benign Het
Zfp93 C T 7: 24,275,861 P424S probably damaging Het
Other mutations in Olfr450
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:Olfr450 APN 6 42818274 missense probably damaging 0.99
IGL01720:Olfr450 APN 6 42817593 missense probably benign 0.00
IGL02457:Olfr450 APN 6 42818242 missense probably damaging 0.97
R1804:Olfr450 UTSW 6 42818221 missense possibly damaging 0.66
R1823:Olfr450 UTSW 6 42818268 missense possibly damaging 0.49
R2115:Olfr450 UTSW 6 42817497 missense possibly damaging 0.65
R4817:Olfr450 UTSW 6 42817962 missense possibly damaging 0.78
R5730:Olfr450 UTSW 6 42818160 nonsense probably null
R5938:Olfr450 UTSW 6 42817767 missense probably damaging 1.00
R6514:Olfr450 UTSW 6 42817996 missense probably damaging 0.97
R7050:Olfr450 UTSW 6 42817570 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TCAATCACTTTGCCTGTGAGACCC -3'
(R):5'- AAATCACTGCATGTCCGAGGAAGAG -3'

Sequencing Primer
(F):5'- CTCTTTCAACAAGGTCATGGTG -3'
(R):5'- TCCTTGTTGAAGCACAAGAGC -3'
Posted On2013-04-24