Incidental Mutation 'R0376:Prr14'
ID30753
Institutional Source Beutler Lab
Gene Symbol Prr14
Ensembl Gene ENSMUSG00000030822
Gene Nameproline rich 14
Synonyms
MMRRC Submission 038582-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R0376 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127459611-127476759 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 127476643 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 181 (H181Y)
Ref Sequence ENSEMBL: ENSMUSP00000145988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033095] [ENSMUST00000106292] [ENSMUST00000133817] [ENSMUST00000133938] [ENSMUST00000205432] [ENSMUST00000206394] [ENSMUST00000206915]
Predicted Effect probably benign
Transcript: ENSMUST00000033095
AA Change: H608Y

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000033095
Gene: ENSMUSG00000030822
AA Change: H608Y

DomainStartEndE-ValueType
low complexity region 241 256 N/A INTRINSIC
low complexity region 263 273 N/A INTRINSIC
low complexity region 297 309 N/A INTRINSIC
low complexity region 364 387 N/A INTRINSIC
Pfam:Tantalus 485 545 5.6e-28 PFAM
low complexity region 554 564 N/A INTRINSIC
low complexity region 587 603 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106292
AA Change: H608Y

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101899
Gene: ENSMUSG00000030822
AA Change: H608Y

DomainStartEndE-ValueType
low complexity region 241 256 N/A INTRINSIC
low complexity region 263 273 N/A INTRINSIC
low complexity region 297 309 N/A INTRINSIC
low complexity region 364 387 N/A INTRINSIC
Pfam:Tantalus 487 544 1.7e-26 PFAM
low complexity region 554 564 N/A INTRINSIC
low complexity region 587 603 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132124
Predicted Effect probably benign
Transcript: ENSMUST00000132819
Predicted Effect probably benign
Transcript: ENSMUST00000133817
Predicted Effect probably benign
Transcript: ENSMUST00000133938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147202
Predicted Effect probably benign
Transcript: ENSMUST00000205432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206118
Predicted Effect probably benign
Transcript: ENSMUST00000206394
Predicted Effect probably benign
Transcript: ENSMUST00000206915
AA Change: H181Y

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206980
Meta Mutation Damage Score 0.1252 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.0%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene tethers heterochromatin to the nuclear laminar scaffold by binding heterochromatin protein 1 (HP1) and the nuclear lamina. The tether is broken during mitosis and reforms quickly after mitosis, with the encoded protein first binding HP1 and then attaching to the nuclear lamina. This protein also has been shown to promote MyoD activity and skeletal myogenesis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik G A 2: 173,528,327 E132K probably benign Het
Adam6a T C 12: 113,544,690 Y228H probably damaging Het
Als2 A G 1: 59,215,565 F211S probably benign Het
Ankrd12 T A 17: 66,053,009 Q11L probably damaging Het
Anxa5 T C 3: 36,460,488 R115G probably damaging Het
Arhgap10 T C 8: 77,450,824 probably benign Het
Atp2a3 T A 11: 72,982,702 D782E probably damaging Het
Bcr G T 10: 75,145,327 L659F probably damaging Het
Cacna1b A G 2: 24,659,003 probably benign Het
Camp C T 9: 109,848,399 C122Y probably damaging Het
Col12a1 A T 9: 79,693,494 S769R probably benign Het
Cyp2j6 T A 4: 96,526,023 K335I probably damaging Het
Cyp3a11 A C 5: 145,862,452 Y308* probably null Het
Flnb G A 14: 7,946,014 probably null Het
Frmd4a G T 2: 4,572,387 M351I probably damaging Het
Gabrg2 C T 11: 41,916,315 S365N possibly damaging Het
Ggn T C 7: 29,173,022 V609A possibly damaging Het
H60c T C 10: 3,260,435 probably benign Het
Hexdc T A 11: 121,218,165 probably benign Het
Igsf9b A G 9: 27,334,582 T1282A probably benign Het
Ikzf4 T C 10: 128,632,756 N618S probably benign Het
Ints14 A G 9: 64,983,990 K418E probably damaging Het
Iqgap1 T C 7: 80,723,879 E1454G probably benign Het
Kif13b T C 14: 64,757,404 probably benign Het
Krt71 A C 15: 101,738,070 F328C probably damaging Het
Lama2 T C 10: 27,015,546 T2524A possibly damaging Het
Mfn2 C T 4: 147,885,526 V363I probably benign Het
Mkln1 A T 6: 31,478,018 D496V probably benign Het
Olfr450 A T 6: 42,818,292 M274L probably benign Het
Patj T A 4: 98,568,987 I1242N probably damaging Het
Pcnx C T 12: 81,974,579 probably benign Het
Plcb2 T C 2: 118,717,240 E502G probably damaging Het
Plppr4 G T 3: 117,323,091 H314Q probably benign Het
Prkcsh A G 9: 22,010,251 probably benign Het
Pus3 A T 9: 35,566,422 M317L possibly damaging Het
Pwwp2a T A 11: 43,704,672 D221E probably benign Het
Rbm15 T C 3: 107,330,938 S715G probably benign Het
Rbm28 A G 6: 29,158,928 probably benign Het
Rhobtb2 A T 14: 69,796,735 V347E probably benign Het
Rimbp2 C T 5: 128,803,861 R161Q probably damaging Het
Scgb1b27 C T 7: 34,021,897 T70I possibly damaging Het
Slc40a1 T C 1: 45,912,491 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spaca9 A G 2: 28,693,660 V104A probably benign Het
Spag7 T C 11: 70,669,190 probably benign Het
Sugp1 A G 8: 70,052,638 D85G probably damaging Het
Sun1 A G 5: 139,226,699 probably benign Het
Tcp11l1 C A 2: 104,697,505 probably benign Het
Tead3 A C 17: 28,341,365 D88E probably damaging Het
Tecpr1 A T 5: 144,207,476 V636E possibly damaging Het
Tldc2 T C 2: 157,095,305 W147R probably damaging Het
Tmem161b A G 13: 84,292,383 T125A probably benign Het
Trrap A G 5: 144,816,339 M1825V probably benign Het
Ttbk2 A G 2: 120,777,581 F186L probably damaging Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Zc3h7a T C 16: 11,156,202 M240V probably benign Het
Zc3hc1 G C 6: 30,372,790 S351W probably damaging Het
Zfp366 T C 13: 99,234,251 M493T probably benign Het
Zfp93 C T 7: 24,275,861 P424S probably damaging Het
Other mutations in Prr14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Prr14 APN 7 127474647 missense probably benign 0.01
IGL01614:Prr14 APN 7 127475133 missense probably damaging 1.00
IGL01655:Prr14 APN 7 127475767 missense probably benign 0.00
IGL02273:Prr14 APN 7 127475936 missense probably damaging 1.00
IGL03033:Prr14 APN 7 127471963 missense probably damaging 1.00
R0364:Prr14 UTSW 7 127474579 missense probably benign 0.01
R0448:Prr14 UTSW 7 127474726 unclassified probably benign
R0555:Prr14 UTSW 7 127472095 unclassified probably benign
R1462:Prr14 UTSW 7 127473988 critical splice donor site probably null
R1462:Prr14 UTSW 7 127473988 critical splice donor site probably null
R1534:Prr14 UTSW 7 127473982 missense probably benign 0.08
R1982:Prr14 UTSW 7 127475490 missense possibly damaging 0.87
R2357:Prr14 UTSW 7 127475363 missense probably benign 0.02
R4729:Prr14 UTSW 7 127474696 missense probably benign 0.00
R5582:Prr14 UTSW 7 127476397 missense probably damaging 1.00
R5757:Prr14 UTSW 7 127475553 missense possibly damaging 0.65
R6497:Prr14 UTSW 7 127474578 missense probably benign 0.03
R6987:Prr14 UTSW 7 127473805 missense possibly damaging 0.94
R7202:Prr14 UTSW 7 127476476 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACCCAGGACCTTTGAGACCATC -3'
(R):5'- TGATTTCAAACTCTGCTGGAGGCAC -3'

Sequencing Primer
(F):5'- AGGACCTTTGAGACCATCTTTGAG -3'
(R):5'- TCTGCTGGAGGCACAAAGG -3'
Posted On2013-04-24