Incidental Mutation 'R3943:6030419C18Rik'
List |< first << previous [record 20 of 585] next >> last >|
ID307546
Institutional Source Beutler Lab
Gene Symbol 6030419C18Rik
Ensembl Gene ENSMUSG00000066607
Gene NameRIKEN cDNA 6030419C18 gene
Synonyms
MMRRC Submission 040924-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R3943 (G1)
Quality Score124
Status Validated
Chromosome9
Chromosomal Location58488603-58499780 bp(+) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) AGAGGAGGAGGAGGAGG to AGAGGAGGAGGAGG at 58499432 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085658] [ENSMUST00000216294]
Predicted Effect probably benign
Transcript: ENSMUST00000085658
SMART Domains Protein: ENSMUSP00000082800
Gene: ENSMUSG00000066607

DomainStartEndE-ValueType
Pfam:DUF4589 52 279 2e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216294
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,269,524 L603* probably null Het
Adnp A G 2: 168,185,060 I105T possibly damaging Het
Atf3 A G 1: 191,171,516 I171T possibly damaging Het
Atp6v0a1 A G 11: 101,055,517 I773V probably benign Het
Cad T A 5: 31,072,385 probably null Het
Camkv T A 9: 107,947,983 D366E possibly damaging Het
Dnah8 T A 17: 30,694,065 probably benign Het
Dock7 A G 4: 98,992,431 S932P probably damaging Het
Fam227a C T 15: 79,620,859 probably benign Het
Fbp2 A G 13: 62,841,793 F233S possibly damaging Het
Gm7534 T C 4: 134,200,345 T366A probably benign Het
Gnptab G T 10: 88,433,894 V820L probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gpr158 C A 2: 21,368,559 R102S possibly damaging Het
Gramd1b A T 9: 40,531,044 M1K probably null Het
H2-T23 A G 17: 36,030,643 V312A probably benign Het
Hltf A T 3: 20,092,744 I494F probably damaging Het
Il16 G A 7: 83,652,015 L300F probably damaging Het
Kcnq1 T C 7: 143,426,088 L657P probably damaging Het
Krt4 G A 15: 101,921,250 T281M probably benign Het
Mia3 A G 1: 183,358,783 F196S possibly damaging Het
Naip6 T C 13: 100,294,739 T1197A probably benign Het
Nrxn2 T A 19: 6,473,335 N204K probably damaging Het
Olfr845 T A 9: 19,339,075 M205K probably benign Het
Rassf6 G T 5: 90,604,326 Q258K possibly damaging Het
Rhpn1 T C 15: 75,711,806 L380P probably damaging Het
Ribc2 A G 15: 85,135,250 M78V probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skint5 T A 4: 113,942,753 H73L probably damaging Het
Smg6 G A 11: 74,929,541 G213R probably damaging Het
Sspn T A 6: 145,934,357 W62R probably damaging Het
Stard9 A G 2: 120,698,229 S1656G probably benign Het
Svep1 T A 4: 58,084,807 probably null Het
Tab1 T C 15: 80,153,740 L258P probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trf T A 9: 103,222,952 I271F probably benign Het
Trpm7 A T 2: 126,831,218 N538K possibly damaging Het
Usp28 T A 9: 49,000,366 L25I probably benign Het
Vmn2r14 A T 5: 109,216,064 I662N probably damaging Het
Vmn2r42 A T 7: 8,194,780 F280Y possibly damaging Het
Vps8 A T 16: 21,470,123 N411Y probably damaging Het
Vwa2 T G 19: 56,909,315 L684R probably damaging Het
Zfp712 T C 13: 67,041,332 Q377R probably benign Het
Zfp947 C A 17: 22,145,820 G291V probably damaging Het
Other mutations in 6030419C18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03367:6030419C18Rik APN 9 58499098 missense probably damaging 1.00
R1234:6030419C18Rik UTSW 9 58499432 small deletion probably benign
R1367:6030419C18Rik UTSW 9 58498980 missense probably damaging 1.00
R1385:6030419C18Rik UTSW 9 58499432 small deletion probably benign
R1615:6030419C18Rik UTSW 9 58499068 missense probably damaging 0.96
R1850:6030419C18Rik UTSW 9 58499109 missense probably benign
R2088:6030419C18Rik UTSW 9 58499005 missense probably damaging 1.00
R3955:6030419C18Rik UTSW 9 58499623 missense probably damaging 1.00
R4614:6030419C18Rik UTSW 9 58499432 small deletion probably benign
R6164:6030419C18Rik UTSW 9 58499247 missense probably damaging 0.96
R6622:6030419C18Rik UTSW 9 58499250 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTACCAGCTCATGAATGGTG -3'
(R):5'- TGATACTGTCTGAGTGCTGC -3'

Sequencing Primer
(F):5'- CTACCAGCTCATGAATGGTGGTTTG -3'
(R):5'- ATACTGTCTGAGTGCTGCTGTTCC -3'
Posted On2015-04-17