Incidental Mutation 'R3943:Trf'
ID307547
Institutional Source Beutler Lab
Gene Symbol Trf
Ensembl Gene ENSMUSG00000032554
Gene Nametransferrin
SynonymsHP, Tfn
MMRRC Submission 040924-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3943 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location103204001-103230444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103222952 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 271 (I271F)
Ref Sequence ENSEMBL: ENSMUSP00000127808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035158] [ENSMUST00000112645] [ENSMUST00000126359] [ENSMUST00000164377] [ENSMUST00000165296] [ENSMUST00000166836] [ENSMUST00000170904]
Predicted Effect probably benign
Transcript: ENSMUST00000035158
AA Change: I285F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035158
Gene: ENSMUSG00000032554
AA Change: I285F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 25 352 5.04e-194 SMART
TR_FER 360 686 8.64e-193 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112503
Predicted Effect probably benign
Transcript: ENSMUST00000112645
AA Change: I285F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108264
Gene: ENSMUSG00000032554
AA Change: I285F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 25 352 5.04e-194 SMART
TR_FER 360 686 8.64e-193 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126359
SMART Domains Protein: ENSMUSP00000120472
Gene: ENSMUSG00000032554

DomainStartEndE-ValueType
TR_FER 22 237 2.25e-77 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164377
SMART Domains Protein: ENSMUSP00000128647
Gene: ENSMUSG00000032554

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Transferrin 25 72 6.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165296
SMART Domains Protein: ENSMUSP00000129013
Gene: ENSMUSG00000032554

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 25 171 5.58e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166836
AA Change: I271F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000127808
Gene: ENSMUSG00000090639
AA Change: I271F

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
TR_FER 25 338 4.98e-175 SMART
TR_FER 346 672 8.64e-193 SMART
Pfam:Arf 758 928 1.5e-15 PFAM
Pfam:SRPRB 769 948 1.4e-73 PFAM
Pfam:MMR_HSR1 773 888 7.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168142
SMART Domains Protein: ENSMUSP00000128609
Gene: ENSMUSG00000032554

DomainStartEndE-ValueType
TR_FER 2 249 1.87e-115 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170904
SMART Domains Protein: ENSMUSP00000128390
Gene: ENSMUSG00000032554

DomainStartEndE-ValueType
TR_FER 15 275 7.6e-139 SMART
Meta Mutation Damage Score 0.0544 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein with an approximate molecular weight of 76.5 kDa. It is thought to have been created as a result of an ancient gene duplication event that led to generation of homologous C and N-terminal domains each of which binds one ion of ferric iron. The function of this protein is to transport iron from the intestine, reticuloendothelial system, and liver parenchymal cells to all proliferating cells in the body. This protein may also have a physiologic role as granulocyte/pollen-binding protein (GPBP) involved in the removal of certain organic matter and allergens from serum. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit refractory iron-deficient, hypochromic, microcytic anemia with iron-loading in the liver, pancreas, heart and brain. Mutants usually die by two weeks of age. Heterozygotes show minor increases in iron stores. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,269,524 L603* probably null Het
6030419C18Rik AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 9: 58,499,432 probably benign Het
Adnp A G 2: 168,185,060 I105T possibly damaging Het
Atf3 A G 1: 191,171,516 I171T possibly damaging Het
Atp6v0a1 A G 11: 101,055,517 I773V probably benign Het
Cad T A 5: 31,072,385 probably null Het
Camkv T A 9: 107,947,983 D366E possibly damaging Het
Dnah8 T A 17: 30,694,065 probably benign Het
Dock7 A G 4: 98,992,431 S932P probably damaging Het
Fam227a C T 15: 79,620,859 probably benign Het
Fbp2 A G 13: 62,841,793 F233S possibly damaging Het
Gm7534 T C 4: 134,200,345 T366A probably benign Het
Gnptab G T 10: 88,433,894 V820L probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gpr158 C A 2: 21,368,559 R102S possibly damaging Het
Gramd1b A T 9: 40,531,044 M1K probably null Het
H2-T23 A G 17: 36,030,643 V312A probably benign Het
Hltf A T 3: 20,092,744 I494F probably damaging Het
Il16 G A 7: 83,652,015 L300F probably damaging Het
Kcnq1 T C 7: 143,426,088 L657P probably damaging Het
Krt4 G A 15: 101,921,250 T281M probably benign Het
Mia3 A G 1: 183,358,783 F196S possibly damaging Het
Naip6 T C 13: 100,294,739 T1197A probably benign Het
Nrxn2 T A 19: 6,473,335 N204K probably damaging Het
Olfr845 T A 9: 19,339,075 M205K probably benign Het
Rassf6 G T 5: 90,604,326 Q258K possibly damaging Het
Rhpn1 T C 15: 75,711,806 L380P probably damaging Het
Ribc2 A G 15: 85,135,250 M78V probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skint5 T A 4: 113,942,753 H73L probably damaging Het
Smg6 G A 11: 74,929,541 G213R probably damaging Het
Sspn T A 6: 145,934,357 W62R probably damaging Het
Stard9 A G 2: 120,698,229 S1656G probably benign Het
Svep1 T A 4: 58,084,807 probably null Het
Tab1 T C 15: 80,153,740 L258P probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trpm7 A T 2: 126,831,218 N538K possibly damaging Het
Usp28 T A 9: 49,000,366 L25I probably benign Het
Vmn2r14 A T 5: 109,216,064 I662N probably damaging Het
Vmn2r42 A T 7: 8,194,780 F280Y possibly damaging Het
Vps8 A T 16: 21,470,123 N411Y probably damaging Het
Vwa2 T G 19: 56,909,315 L684R probably damaging Het
Zfp712 T C 13: 67,041,332 Q377R probably benign Het
Zfp947 C A 17: 22,145,820 G291V probably damaging Het
Other mutations in Trf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Trf APN 9 103220957 missense probably benign 0.00
IGL00424:Trf APN 9 103226936 missense probably damaging 1.00
IGL00793:Trf APN 9 103226143 unclassified probably benign
IGL01139:Trf APN 9 103223604 missense probably damaging 1.00
IGL01658:Trf APN 9 103226856 missense probably benign 0.04
IGL02671:Trf APN 9 103211982 missense probably benign 0.01
IGL02996:Trf APN 9 103220903 missense probably benign 0.01
R0060:Trf UTSW 9 103220922 missense probably benign 0.11
R0060:Trf UTSW 9 103220922 missense probably benign 0.11
R0096:Trf UTSW 9 103222159 missense probably damaging 1.00
R0096:Trf UTSW 9 103222159 missense probably damaging 1.00
R0112:Trf UTSW 9 103226956 unclassified probably benign
R0234:Trf UTSW 9 103226879 unclassified probably null
R0234:Trf UTSW 9 103226879 unclassified probably null
R0411:Trf UTSW 9 103217501 missense probably damaging 1.00
R0456:Trf UTSW 9 103226903 missense probably damaging 1.00
R0601:Trf UTSW 9 103222933 critical splice donor site probably null
R1419:Trf UTSW 9 103226108 missense probably damaging 1.00
R1606:Trf UTSW 9 103225136 splice site probably null
R4431:Trf UTSW 9 103211876 missense possibly damaging 0.81
R4609:Trf UTSW 9 103211985 missense possibly damaging 0.81
R4658:Trf UTSW 9 103223608 missense probably damaging 1.00
R4830:Trf UTSW 9 103227915 missense probably damaging 0.98
R4925:Trf UTSW 9 103219246 missense probably benign 0.00
R4929:Trf UTSW 9 103227875 intron probably benign
R4931:Trf UTSW 9 103228048 missense probably damaging 0.99
R5139:Trf UTSW 9 103222934 critical splice donor site probably null
R5272:Trf UTSW 9 103227978 missense probably damaging 1.00
R5692:Trf UTSW 9 103226125 missense possibly damaging 0.87
R6227:Trf UTSW 9 103230305 start gained probably benign
R6365:Trf UTSW 9 103222128 missense possibly damaging 0.70
R6928:Trf UTSW 9 103222108 missense possibly damaging 0.56
R7127:Trf UTSW 9 103225127 missense probably benign
R7231:Trf UTSW 9 103225148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTCTCTGGGCCTTGAGG -3'
(R):5'- CATGCTTTCAATGCTAACAGGAC -3'

Sequencing Primer
(F):5'- CCTTGAGGGCCTAATTCAGATG -3'
(R):5'- TGCTAACAGGACTTCAAAAATGG -3'
Posted On2015-04-17