Incidental Mutation 'R3943:Tab1'
ID307561
Institutional Source Beutler Lab
Gene Symbol Tab1
Ensembl Gene ENSMUSG00000022414
Gene NameTGF-beta activated kinase 1/MAP3K7 binding protein 1
Synonyms2310012M03Rik, Map3k7ip1, b2b449Clo, Tak1-binding protein 1
MMRRC Submission 040924-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3943 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location80133127-80161707 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80153740 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 258 (L258P)
Ref Sequence ENSEMBL: ENSMUSP00000023050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023050] [ENSMUST00000229320]
PDB Structure
Structural basis of autoactivation of p38 alpha induced by TAB1 (Monoclinic crystal form) [X-RAY DIFFRACTION]
Structural basis of autoactivation of p38 alpha induced by TAB1 (Tetragonal crystal form) [X-RAY DIFFRACTION]
Structural basis of autoactivation of p38 alpha induced by TAB1 (Tetragonal crystal form with bound sulphate) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000023050
AA Change: L258P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023050
Gene: ENSMUSG00000022414
AA Change: L258P

DomainStartEndE-ValueType
PP2Cc 26 363 7.45e-40 SMART
low complexity region 397 408 N/A INTRINSIC
low complexity region 438 455 N/A INTRINSIC
PDB:4L3P|A 466 502 6e-17 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000229320
Meta Mutation Damage Score 0.338 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified as a regulator of the MAP kinase kinase kinase MAP3K7/TAK1, which is known to mediate various intracellular signaling pathways, such as those induced by TGF beta, interleukin 1, and WNT-1. This protein interacts and thus activates TAK1 kinase. It has been shown that the C-terminal portion of this protein is sufficient for binding and activation of TAK1, while a portion of the N-terminus acts as a dominant-negative inhibitor of TGF beta, suggesting that this protein may function as a mediator between TGF beta receptors and TAK1. This protein can also interact with and activate the mitogen-activated protein kinase 14 (MAPK14/p38alpha), and thus represents an alternative activation pathway, in addition to the MAPKK pathways, which contributes to the biological responses of MAPK14 to various stimuli. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant fetuses exhibit edema, hemorrhaging, cardiovascular and pulmonary dysmorphogenesis, and die in the late stages of gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,269,524 L603* probably null Het
6030419C18Rik AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 9: 58,499,432 probably benign Het
Adnp A G 2: 168,185,060 I105T possibly damaging Het
Atf3 A G 1: 191,171,516 I171T possibly damaging Het
Atp6v0a1 A G 11: 101,055,517 I773V probably benign Het
Cad T A 5: 31,072,385 probably null Het
Camkv T A 9: 107,947,983 D366E possibly damaging Het
Dnah8 T A 17: 30,694,065 probably benign Het
Dock7 A G 4: 98,992,431 S932P probably damaging Het
Fam227a C T 15: 79,620,859 probably benign Het
Fbp2 A G 13: 62,841,793 F233S possibly damaging Het
Gm7534 T C 4: 134,200,345 T366A probably benign Het
Gnptab G T 10: 88,433,894 V820L probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gpr158 C A 2: 21,368,559 R102S possibly damaging Het
Gramd1b A T 9: 40,531,044 M1K probably null Het
H2-T23 A G 17: 36,030,643 V312A probably benign Het
Hltf A T 3: 20,092,744 I494F probably damaging Het
Il16 G A 7: 83,652,015 L300F probably damaging Het
Kcnq1 T C 7: 143,426,088 L657P probably damaging Het
Krt4 G A 15: 101,921,250 T281M probably benign Het
Mia3 A G 1: 183,358,783 F196S possibly damaging Het
Naip6 T C 13: 100,294,739 T1197A probably benign Het
Nrxn2 T A 19: 6,473,335 N204K probably damaging Het
Olfr845 T A 9: 19,339,075 M205K probably benign Het
Rassf6 G T 5: 90,604,326 Q258K possibly damaging Het
Rhpn1 T C 15: 75,711,806 L380P probably damaging Het
Ribc2 A G 15: 85,135,250 M78V probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skint5 T A 4: 113,942,753 H73L probably damaging Het
Smg6 G A 11: 74,929,541 G213R probably damaging Het
Sspn T A 6: 145,934,357 W62R probably damaging Het
Stard9 A G 2: 120,698,229 S1656G probably benign Het
Svep1 T A 4: 58,084,807 probably null Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trf T A 9: 103,222,952 I271F probably benign Het
Trpm7 A T 2: 126,831,218 N538K possibly damaging Het
Usp28 T A 9: 49,000,366 L25I probably benign Het
Vmn2r14 A T 5: 109,216,064 I662N probably damaging Het
Vmn2r42 A T 7: 8,194,780 F280Y possibly damaging Het
Vps8 A T 16: 21,470,123 N411Y probably damaging Het
Vwa2 T G 19: 56,909,315 L684R probably damaging Het
Zfp712 T C 13: 67,041,332 Q377R probably benign Het
Zfp947 C A 17: 22,145,820 G291V probably damaging Het
Other mutations in Tab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02686:Tab1 APN 15 80148830 missense probably benign 0.05
memento UTSW 15 80153668 missense probably damaging 0.96
Memoir UTSW 15 80153740 missense probably damaging 1.00
R0085:Tab1 UTSW 15 80155893 missense probably benign 0.00
R1341:Tab1 UTSW 15 80160114 missense possibly damaging 0.86
R1835:Tab1 UTSW 15 80148296 missense probably benign 0.42
R1907:Tab1 UTSW 15 80153668 missense probably damaging 0.96
R3113:Tab1 UTSW 15 80148260 missense probably benign 0.23
R3944:Tab1 UTSW 15 80153740 missense probably damaging 1.00
R4845:Tab1 UTSW 15 80152763 missense probably damaging 1.00
R5345:Tab1 UTSW 15 80149813 missense possibly damaging 0.48
R5696:Tab1 UTSW 15 80148729 nonsense probably null
R6223:Tab1 UTSW 15 80148263 missense probably damaging 1.00
R6242:Tab1 UTSW 15 80155770 nonsense probably null
R6561:Tab1 UTSW 15 80148830 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGTAGGCGGAGACCTGTTAG -3'
(R):5'- AGCTCACAGGATCAGACTGC -3'

Sequencing Primer
(F):5'- TGTGACTCTCCATCATGACAGGG -3'
(R):5'- TCAGACTGCTGACCTAGGC -3'
Posted On2015-04-17