Incidental Mutation 'R3943:Krt4'
ID307563
Institutional Source Beutler Lab
Gene Symbol Krt4
Ensembl Gene ENSMUSG00000059668
Gene Namekeratin 4
SynonymsKrt-2.4, K4, Krt2-4
MMRRC Submission 040924-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R3943 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location101918535-101924735 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101921250 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 281 (T281M)
Ref Sequence ENSEMBL: ENSMUSP00000023797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023797]
Predicted Effect probably benign
Transcript: ENSMUST00000023797
AA Change: T281M

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000023797
Gene: ENSMUSG00000059668
AA Change: T281M

DomainStartEndE-ValueType
Pfam:Keratin_2_head 14 142 4.7e-37 PFAM
Filament 145 458 1.61e-166 SMART
low complexity region 465 511 N/A INTRINSIC
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in differentiated layers of the mucosal and esophageal epithelia with family member KRT13. Mutations in these genes have been associated with White Sponge Nevus, characterized by oral, esophageal, and anal leukoplakia. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display hyperplasia throughout the epithelium of the esophagus and tongue. Mice homozygous or heterozygous for a dominant mutation display oral leukoplakia and homozygotes display postnatal growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,269,524 L603* probably null Het
6030419C18Rik AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 9: 58,499,432 probably benign Het
Adnp A G 2: 168,185,060 I105T possibly damaging Het
Atf3 A G 1: 191,171,516 I171T possibly damaging Het
Atp6v0a1 A G 11: 101,055,517 I773V probably benign Het
Cad T A 5: 31,072,385 probably null Het
Camkv T A 9: 107,947,983 D366E possibly damaging Het
Dnah8 T A 17: 30,694,065 probably benign Het
Dock7 A G 4: 98,992,431 S932P probably damaging Het
Fam227a C T 15: 79,620,859 probably benign Het
Fbp2 A G 13: 62,841,793 F233S possibly damaging Het
Gm7534 T C 4: 134,200,345 T366A probably benign Het
Gnptab G T 10: 88,433,894 V820L probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gpr158 C A 2: 21,368,559 R102S possibly damaging Het
Gramd1b A T 9: 40,531,044 M1K probably null Het
H2-T23 A G 17: 36,030,643 V312A probably benign Het
Hltf A T 3: 20,092,744 I494F probably damaging Het
Il16 G A 7: 83,652,015 L300F probably damaging Het
Kcnq1 T C 7: 143,426,088 L657P probably damaging Het
Mia3 A G 1: 183,358,783 F196S possibly damaging Het
Naip6 T C 13: 100,294,739 T1197A probably benign Het
Nrxn2 T A 19: 6,473,335 N204K probably damaging Het
Olfr845 T A 9: 19,339,075 M205K probably benign Het
Rassf6 G T 5: 90,604,326 Q258K possibly damaging Het
Rhpn1 T C 15: 75,711,806 L380P probably damaging Het
Ribc2 A G 15: 85,135,250 M78V probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skint5 T A 4: 113,942,753 H73L probably damaging Het
Smg6 G A 11: 74,929,541 G213R probably damaging Het
Sspn T A 6: 145,934,357 W62R probably damaging Het
Stard9 A G 2: 120,698,229 S1656G probably benign Het
Svep1 T A 4: 58,084,807 probably null Het
Tab1 T C 15: 80,153,740 L258P probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trf T A 9: 103,222,952 I271F probably benign Het
Trpm7 A T 2: 126,831,218 N538K possibly damaging Het
Usp28 T A 9: 49,000,366 L25I probably benign Het
Vmn2r14 A T 5: 109,216,064 I662N probably damaging Het
Vmn2r42 A T 7: 8,194,780 F280Y possibly damaging Het
Vps8 A T 16: 21,470,123 N411Y probably damaging Het
Vwa2 T G 19: 56,909,315 L684R probably damaging Het
Zfp712 T C 13: 67,041,332 Q377R probably benign Het
Zfp947 C A 17: 22,145,820 G291V probably damaging Het
Other mutations in Krt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Krt4 APN 15 101920281 missense probably damaging 1.00
IGL02306:Krt4 APN 15 101921305 missense probably benign 0.13
IGL02407:Krt4 APN 15 101921305 missense probably benign 0.13
IGL02504:Krt4 APN 15 101919292 missense unknown
R0042:Krt4 UTSW 15 101922752 splice site probably benign
R0042:Krt4 UTSW 15 101922752 splice site probably benign
R0211:Krt4 UTSW 15 101922782 missense possibly damaging 0.80
R0363:Krt4 UTSW 15 101924646 missense possibly damaging 0.91
R2018:Krt4 UTSW 15 101920651 missense probably damaging 1.00
R2067:Krt4 UTSW 15 101924664 missense possibly damaging 0.70
R2571:Krt4 UTSW 15 101921257 missense probably damaging 1.00
R3944:Krt4 UTSW 15 101921250 missense probably benign 0.00
R5104:Krt4 UTSW 15 101920323 missense probably damaging 1.00
R5107:Krt4 UTSW 15 101922791 missense possibly damaging 0.89
R5579:Krt4 UTSW 15 101921234 missense probably benign 0.01
R6052:Krt4 UTSW 15 101922759 critical splice donor site probably null
R6429:Krt4 UTSW 15 101922794 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGAAACTCTCCACTGACTCTC -3'
(R):5'- GCATAGCGATCTTGCACAGC -3'

Sequencing Primer
(F):5'- ACTGACTCTCTCACTATACTCCAG -3'
(R):5'- CACAGCCTTTTAGAATGTGTAAGGG -3'
Posted On2015-04-17