Incidental Mutation 'R3944:Spout1'
ID307574
Institutional Source Beutler Lab
Gene Symbol Spout1
Ensembl Gene ENSMUSG00000039660
Gene NameSPOUT domain containing methyltransferase 1
SynonymsD2Wsu81e
MMRRC Submission 040925-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock #R3944 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location30173453-30178459 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30174136 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 372 (V372A)
Ref Sequence ENSEMBL: ENSMUSP00000097793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015481] [ENSMUST00000100220]
Predicted Effect probably benign
Transcript: ENSMUST00000015481
SMART Domains Protein: ENSMUSP00000015481
Gene: ENSMUSG00000015337

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 30 62 N/A INTRINSIC
Endonuclease_NS 74 282 3.07e-79 SMART
NUC 75 282 3.37e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100220
AA Change: V372A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097793
Gene: ENSMUSG00000039660
AA Change: V372A

DomainStartEndE-ValueType
coiled coil region 36 72 N/A INTRINSIC
Pfam:Methyltrn_RNA_3 75 365 2.5e-114 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146466
Meta Mutation Damage Score 0.1128 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality before implantation. Heterozygotes show reduced spontaneous apoptosis of differentiating spermatogonia as well as reduced apoptosis and nuclear DNA fragmentation in splenocytes, thymocytes and MEFs in response to apoptotic stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,269,524 L603* probably null Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4932438A13Rik A G 3: 37,030,061 I3876V possibly damaging Het
6430548M08Rik T C 8: 120,152,502 L213P probably damaging Het
Akap12 A G 10: 4,357,347 K1491E probably benign Het
Akr1c12 T A 13: 4,279,340 H6L probably benign Het
Ankrd50 C T 3: 38,452,496 C251Y probably benign Het
Calu T C 6: 29,361,711 S125P possibly damaging Het
Cdh10 A G 15: 18,964,249 T166A probably benign Het
Clip1 T C 5: 123,617,829 probably benign Het
Cntn4 T G 6: 106,618,414 N497K probably benign Het
Cspg4 T A 9: 56,886,123 C381S probably damaging Het
Cyp1a2 T C 9: 57,681,868 N221S probably benign Het
Dnaaf5 C T 5: 139,152,924 probably benign Het
Dnah7b A G 1: 46,137,485 D755G probably damaging Het
Dscam A T 16: 96,820,997 V418E probably damaging Het
Eefsec T A 6: 88,298,094 H296L probably benign Het
Elmo3 T C 8: 105,309,220 probably null Het
Gcm1 C T 9: 78,059,816 Q106* probably null Het
Gnl1 G T 17: 35,988,521 G528V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
H2-T23 A G 17: 36,030,643 V312A probably benign Het
Hectd4 C A 5: 121,303,525 probably benign Het
Hoxa7 T A 6: 52,216,626 probably benign Het
Ifnlr1 T A 4: 135,701,228 V122E probably damaging Het
Kcnt2 T C 1: 140,584,287 M1036T probably damaging Het
Khdc1b G T 1: 21,384,806 K96N probably damaging Het
Kif19a A T 11: 114,786,735 Y578F probably benign Het
Krt4 G A 15: 101,921,250 T281M probably benign Het
Lyl1 A C 8: 84,704,002 T178P probably damaging Het
March6 A G 15: 31,488,814 V317A probably benign Het
Mmp1b G A 9: 7,384,708 T280I possibly damaging Het
Mpi T C 9: 57,545,253 D332G probably damaging Het
Naip6 T C 13: 100,294,739 T1197A probably benign Het
Ntng2 G A 2: 29,204,277 L361F probably benign Het
Obscn A T 11: 59,132,547 I668N probably damaging Het
Olfr1090 A G 2: 86,754,181 S186P probably benign Het
Olfr686 A T 7: 105,203,955 C129* probably null Het
Pabpc1l A G 2: 164,042,327 E328G probably damaging Het
Pan3 A T 5: 147,450,730 N170Y probably damaging Het
Prdm2 C T 4: 143,131,815 R1635Q possibly damaging Het
Rassf6 G T 5: 90,604,326 Q258K possibly damaging Het
Ribc2 A G 15: 85,135,250 M78V probably benign Het
Rp9 A C 9: 22,449,858 H44Q probably damaging Het
Skint5 T A 4: 113,942,753 H73L probably damaging Het
Slc6a12 A T 6: 121,354,280 probably null Het
Smg6 G A 11: 74,929,541 G213R probably damaging Het
Svep1 T A 4: 58,084,807 probably null Het
Tab1 T C 15: 80,153,740 L258P probably damaging Het
Tbl3 A G 17: 24,700,708 S791P possibly damaging Het
Tcof1 C A 18: 60,822,837 D927Y probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Topaz1 T C 9: 122,750,604 S860P possibly damaging Het
Vill T C 9: 119,068,431 I258T probably benign Het
Vmn1r204 G A 13: 22,556,844 R215H probably benign Het
Vmn2r106 A T 17: 20,267,651 F829I probably damaging Het
Vmn2r14 A T 5: 109,216,064 I662N probably damaging Het
Vmn2r58 A T 7: 41,864,461 F253I probably benign Het
Vps8 A T 16: 21,470,123 N411Y probably damaging Het
Zfp932 T A 5: 110,009,954 V506E probably benign Het
Other mutations in Spout1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02072:Spout1 APN 2 30177926 nonsense probably null
IGL02232:Spout1 APN 2 30175254 missense probably damaging 1.00
IGL03141:Spout1 APN 2 30175055 missense probably damaging 1.00
R0496:Spout1 UTSW 2 30174971 missense probably benign 0.00
R3847:Spout1 UTSW 2 30177407 unclassified probably null
R4162:Spout1 UTSW 2 30177577 intron probably benign
R4163:Spout1 UTSW 2 30177577 intron probably benign
R4164:Spout1 UTSW 2 30177577 intron probably benign
Predicted Primers PCR Primer
(F):5'- CGTGCCCAATATTCTGGCTC -3'
(R):5'- TCTGAAGTCTTGCCCATATCAC -3'

Sequencing Primer
(F):5'- ATATTCTGGCTCGAGCTGGAAACC -3'
(R):5'- AGTCTTGCCCATATCACTAATTACTG -3'
Posted On2015-04-17