Incidental Mutation 'R3944:Olfr1090'
ID307575
Institutional Source Beutler Lab
Gene Symbol Olfr1090
Ensembl Gene ENSMUSG00000075172
Gene Nameolfactory receptor 1090
SynonymsGA_x6K02T2Q125-48247345-48246404, MOR188-4
MMRRC Submission 040925-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R3944 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86752724-86758993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86754181 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 186 (S186P)
Ref Sequence ENSEMBL: ENSMUSP00000149968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099875] [ENSMUST00000215991] [ENSMUST00000217043]
Predicted Effect probably benign
Transcript: ENSMUST00000099875
AA Change: S186P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000097460
Gene: ENSMUSG00000075172
AA Change: S186P

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.4e-47 PFAM
Pfam:7tm_1 41 290 7.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215991
AA Change: S186P

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000217043
AA Change: S186P

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.1516 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,269,524 L603* probably null Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4932438A13Rik A G 3: 37,030,061 I3876V possibly damaging Het
6430548M08Rik T C 8: 120,152,502 L213P probably damaging Het
Akap12 A G 10: 4,357,347 K1491E probably benign Het
Akr1c12 T A 13: 4,279,340 H6L probably benign Het
Ankrd50 C T 3: 38,452,496 C251Y probably benign Het
Calu T C 6: 29,361,711 S125P possibly damaging Het
Cdh10 A G 15: 18,964,249 T166A probably benign Het
Clip1 T C 5: 123,617,829 probably benign Het
Cntn4 T G 6: 106,618,414 N497K probably benign Het
Cspg4 T A 9: 56,886,123 C381S probably damaging Het
Cyp1a2 T C 9: 57,681,868 N221S probably benign Het
Dnaaf5 C T 5: 139,152,924 probably benign Het
Dnah7b A G 1: 46,137,485 D755G probably damaging Het
Dscam A T 16: 96,820,997 V418E probably damaging Het
Eefsec T A 6: 88,298,094 H296L probably benign Het
Elmo3 T C 8: 105,309,220 probably null Het
Gcm1 C T 9: 78,059,816 Q106* probably null Het
Gnl1 G T 17: 35,988,521 G528V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
H2-T23 A G 17: 36,030,643 V312A probably benign Het
Hectd4 C A 5: 121,303,525 probably benign Het
Hoxa7 T A 6: 52,216,626 probably benign Het
Ifnlr1 T A 4: 135,701,228 V122E probably damaging Het
Kcnt2 T C 1: 140,584,287 M1036T probably damaging Het
Khdc1b G T 1: 21,384,806 K96N probably damaging Het
Kif19a A T 11: 114,786,735 Y578F probably benign Het
Krt4 G A 15: 101,921,250 T281M probably benign Het
Lyl1 A C 8: 84,704,002 T178P probably damaging Het
March6 A G 15: 31,488,814 V317A probably benign Het
Mmp1b G A 9: 7,384,708 T280I possibly damaging Het
Mpi T C 9: 57,545,253 D332G probably damaging Het
Naip6 T C 13: 100,294,739 T1197A probably benign Het
Ntng2 G A 2: 29,204,277 L361F probably benign Het
Obscn A T 11: 59,132,547 I668N probably damaging Het
Olfr686 A T 7: 105,203,955 C129* probably null Het
Pabpc1l A G 2: 164,042,327 E328G probably damaging Het
Pan3 A T 5: 147,450,730 N170Y probably damaging Het
Prdm2 C T 4: 143,131,815 R1635Q possibly damaging Het
Rassf6 G T 5: 90,604,326 Q258K possibly damaging Het
Ribc2 A G 15: 85,135,250 M78V probably benign Het
Rp9 A C 9: 22,449,858 H44Q probably damaging Het
Skint5 T A 4: 113,942,753 H73L probably damaging Het
Slc6a12 A T 6: 121,354,280 probably null Het
Smg6 G A 11: 74,929,541 G213R probably damaging Het
Spout1 A G 2: 30,174,136 V372A probably benign Het
Svep1 T A 4: 58,084,807 probably null Het
Tab1 T C 15: 80,153,740 L258P probably damaging Het
Tbl3 A G 17: 24,700,708 S791P possibly damaging Het
Tcof1 C A 18: 60,822,837 D927Y probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Topaz1 T C 9: 122,750,604 S860P possibly damaging Het
Vill T C 9: 119,068,431 I258T probably benign Het
Vmn1r204 G A 13: 22,556,844 R215H probably benign Het
Vmn2r106 A T 17: 20,267,651 F829I probably damaging Het
Vmn2r14 A T 5: 109,216,064 I662N probably damaging Het
Vmn2r58 A T 7: 41,864,461 F253I probably benign Het
Vps8 A T 16: 21,470,123 N411Y probably damaging Het
Zfp932 T A 5: 110,009,954 V506E probably benign Het
Other mutations in Olfr1090
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Olfr1090 APN 2 86753970 missense probably benign 0.42
IGL01343:Olfr1090 APN 2 86754499 nonsense probably null
IGL01431:Olfr1090 APN 2 86754164 missense probably benign 0.12
IGL01771:Olfr1090 APN 2 86754282 missense probably benign 0.15
IGL03182:Olfr1090 APN 2 86754022 missense probably damaging 1.00
IGL03229:Olfr1090 APN 2 86754016 missense probably damaging 1.00
R0126:Olfr1090 UTSW 2 86754637 missense probably damaging 0.99
R0128:Olfr1090 UTSW 2 86753887 missense probably benign 0.39
R0130:Olfr1090 UTSW 2 86753887 missense probably benign 0.39
R1383:Olfr1090 UTSW 2 86754494 missense possibly damaging 0.80
R2100:Olfr1090 UTSW 2 86754561 missense possibly damaging 0.80
R2125:Olfr1090 UTSW 2 86754452 missense probably benign 0.00
R2126:Olfr1090 UTSW 2 86754452 missense probably benign 0.00
R2249:Olfr1090 UTSW 2 86754054 missense probably damaging 0.98
R3695:Olfr1090 UTSW 2 86753871 missense probably damaging 1.00
R3878:Olfr1090 UTSW 2 86754628 missense probably benign 0.02
R3940:Olfr1090 UTSW 2 86753931 missense possibly damaging 0.52
R3975:Olfr1090 UTSW 2 86754543 missense probably damaging 0.99
R4387:Olfr1090 UTSW 2 86754120 missense probably benign 0.42
R4623:Olfr1090 UTSW 2 86754562 missense possibly damaging 0.80
R4740:Olfr1090 UTSW 2 86753811 missense probably benign 0.00
R6775:Olfr1090 UTSW 2 86754577 missense probably damaging 1.00
R7002:Olfr1090 UTSW 2 86754681 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACACTGTCACCACTGTCAG -3'
(R):5'- ATGTCCTATGACCGCTATGTGG -3'

Sequencing Primer
(F):5'- ACTGTCAGGTGGGACCC -3'
(R):5'- ACCGCTATGTGGCCATCTGTAAG -3'
Posted On2015-04-17