Incidental Mutation 'R3944:Ifnlr1'
ID307580
Institutional Source Beutler Lab
Gene Symbol Ifnlr1
Ensembl Gene ENSMUSG00000062157
Gene Nameinterferon lambda receptor 1
SynonymsIFNLR1, Il28ra, CRF2-12
MMRRC Submission 040925-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3944 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location135686287-135708181 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 135701228 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 122 (V122E)
Ref Sequence ENSEMBL: ENSMUSP00000074009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074408]
Predicted Effect probably damaging
Transcript: ENSMUST00000074408
AA Change: V122E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074009
Gene: ENSMUSG00000062157
AA Change: V122E

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
FN3 24 108 7.75e0 SMART
transmembrane domain 226 248 N/A INTRINSIC
low complexity region 320 337 N/A INTRINSIC
low complexity region 376 397 N/A INTRINSIC
low complexity region 482 505 N/A INTRINSIC
Meta Mutation Damage Score 0.352 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the class II cytokine receptor family. This protein forms a receptor complex with interleukine 10 receptor, beta (IL10RB). The receptor complex has been shown to interact with three closely related cytokines, including interleukin 28A (IL28A), interleukin 28B (IL28B), and interleukin 29 (IL29). The expression of all three cytokines can be induced by viral infection. The cells overexpressing this protein have been found to have enhanced responses to IL28A and IL29, but decreased response to IL28B. Three alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and normal with respect to viral infection, however antiviral response evoked by TLRs are significantly reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,269,524 L603* probably null Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4932438A13Rik A G 3: 37,030,061 I3876V possibly damaging Het
6430548M08Rik T C 8: 120,152,502 L213P probably damaging Het
Akap12 A G 10: 4,357,347 K1491E probably benign Het
Akr1c12 T A 13: 4,279,340 H6L probably benign Het
Ankrd50 C T 3: 38,452,496 C251Y probably benign Het
Calu T C 6: 29,361,711 S125P possibly damaging Het
Cdh10 A G 15: 18,964,249 T166A probably benign Het
Clip1 T C 5: 123,617,829 probably benign Het
Cntn4 T G 6: 106,618,414 N497K probably benign Het
Cspg4 T A 9: 56,886,123 C381S probably damaging Het
Cyp1a2 T C 9: 57,681,868 N221S probably benign Het
Dnaaf5 C T 5: 139,152,924 probably benign Het
Dnah7b A G 1: 46,137,485 D755G probably damaging Het
Dscam A T 16: 96,820,997 V418E probably damaging Het
Eefsec T A 6: 88,298,094 H296L probably benign Het
Elmo3 T C 8: 105,309,220 probably null Het
Gcm1 C T 9: 78,059,816 Q106* probably null Het
Gnl1 G T 17: 35,988,521 G528V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
H2-T23 A G 17: 36,030,643 V312A probably benign Het
Hectd4 C A 5: 121,303,525 probably benign Het
Hoxa7 T A 6: 52,216,626 probably benign Het
Kcnt2 T C 1: 140,584,287 M1036T probably damaging Het
Khdc1b G T 1: 21,384,806 K96N probably damaging Het
Kif19a A T 11: 114,786,735 Y578F probably benign Het
Krt4 G A 15: 101,921,250 T281M probably benign Het
Lyl1 A C 8: 84,704,002 T178P probably damaging Het
March6 A G 15: 31,488,814 V317A probably benign Het
Mmp1b G A 9: 7,384,708 T280I possibly damaging Het
Mpi T C 9: 57,545,253 D332G probably damaging Het
Naip6 T C 13: 100,294,739 T1197A probably benign Het
Ntng2 G A 2: 29,204,277 L361F probably benign Het
Obscn A T 11: 59,132,547 I668N probably damaging Het
Olfr1090 A G 2: 86,754,181 S186P probably benign Het
Olfr686 A T 7: 105,203,955 C129* probably null Het
Pabpc1l A G 2: 164,042,327 E328G probably damaging Het
Pan3 A T 5: 147,450,730 N170Y probably damaging Het
Prdm2 C T 4: 143,131,815 R1635Q possibly damaging Het
Rassf6 G T 5: 90,604,326 Q258K possibly damaging Het
Ribc2 A G 15: 85,135,250 M78V probably benign Het
Rp9 A C 9: 22,449,858 H44Q probably damaging Het
Skint5 T A 4: 113,942,753 H73L probably damaging Het
Slc6a12 A T 6: 121,354,280 probably null Het
Smg6 G A 11: 74,929,541 G213R probably damaging Het
Spout1 A G 2: 30,174,136 V372A probably benign Het
Svep1 T A 4: 58,084,807 probably null Het
Tab1 T C 15: 80,153,740 L258P probably damaging Het
Tbl3 A G 17: 24,700,708 S791P possibly damaging Het
Tcof1 C A 18: 60,822,837 D927Y probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Topaz1 T C 9: 122,750,604 S860P possibly damaging Het
Vill T C 9: 119,068,431 I258T probably benign Het
Vmn1r204 G A 13: 22,556,844 R215H probably benign Het
Vmn2r106 A T 17: 20,267,651 F829I probably damaging Het
Vmn2r14 A T 5: 109,216,064 I662N probably damaging Het
Vmn2r58 A T 7: 41,864,461 F253I probably benign Het
Vps8 A T 16: 21,470,123 N411Y probably damaging Het
Zfp932 T A 5: 110,009,954 V506E probably benign Het
Other mutations in Ifnlr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Ifnlr1 APN 4 135704285 missense probably benign 0.28
IGL01637:Ifnlr1 APN 4 135686545 missense possibly damaging 0.63
IGL02090:Ifnlr1 APN 4 135705267 missense probably benign 0.23
R0677:Ifnlr1 UTSW 4 135705634 missense possibly damaging 0.78
R0723:Ifnlr1 UTSW 4 135701213 splice site probably benign
R0762:Ifnlr1 UTSW 4 135701329 missense possibly damaging 0.90
R1169:Ifnlr1 UTSW 4 135705108 missense probably benign 0.00
R1303:Ifnlr1 UTSW 4 135704217 missense possibly damaging 0.67
R1819:Ifnlr1 UTSW 4 135686523 start gained probably benign
R1957:Ifnlr1 UTSW 4 135686570 missense probably damaging 1.00
R2041:Ifnlr1 UTSW 4 135705837 missense possibly damaging 0.51
R2509:Ifnlr1 UTSW 4 135705248 missense probably damaging 1.00
R2510:Ifnlr1 UTSW 4 135705248 missense probably damaging 1.00
R2511:Ifnlr1 UTSW 4 135705248 missense probably damaging 1.00
R3020:Ifnlr1 UTSW 4 135705730 small deletion probably benign
R4495:Ifnlr1 UTSW 4 135705768 missense probably damaging 0.98
R4804:Ifnlr1 UTSW 4 135705336 missense possibly damaging 0.50
R4938:Ifnlr1 UTSW 4 135705282 missense probably benign 0.35
R5070:Ifnlr1 UTSW 4 135704198 missense probably benign 0.00
R5073:Ifnlr1 UTSW 4 135705146 missense probably benign 0.06
R5493:Ifnlr1 UTSW 4 135705566 missense probably benign 0.25
R5913:Ifnlr1 UTSW 4 135705269 missense probably damaging 1.00
R5913:Ifnlr1 UTSW 4 135705270 missense probably damaging 1.00
R5959:Ifnlr1 UTSW 4 135705341 missense possibly damaging 0.94
R6032:Ifnlr1 UTSW 4 135705626 missense probably benign 0.03
R6032:Ifnlr1 UTSW 4 135705626 missense probably benign 0.03
R6136:Ifnlr1 UTSW 4 135703797 missense possibly damaging 0.92
R7018:Ifnlr1 UTSW 4 135703824 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AGTCGGACAGTGATGCTTC -3'
(R):5'- AAACCATGGAAGGCCTCTTG -3'

Sequencing Primer
(F):5'- GATGCTTCCCTCCCAGAGATAGTG -3'
(R):5'- CCTCTTGGAGGGAAGTACAGG -3'
Posted On2015-04-17