Incidental Mutation 'R3944:Cntn4'
ID307591
Institutional Source Beutler Lab
Gene Symbol Cntn4
Ensembl Gene ENSMUSG00000064293
Gene Namecontactin 4
SynonymsBIG-2A, Axcam
MMRRC Submission 040925-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.519) question?
Stock #R3944 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location105677660-106699310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 106618414 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 497 (N497K)
Ref Sequence ENSEMBL: ENSMUSP00000108883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079416] [ENSMUST00000089208] [ENSMUST00000113258] [ENSMUST00000113260] [ENSMUST00000113261] [ENSMUST00000113264]
Predicted Effect probably benign
Transcript: ENSMUST00000079416
SMART Domains Protein: ENSMUSP00000078385
Gene: ENSMUSG00000064293

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089208
SMART Domains Protein: ENSMUSP00000086616
Gene: ENSMUSG00000064293

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
FN3 700 786 8.39e0 SMART
FN3 801 886 1.33e-6 SMART
FN3 901 981 9.85e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113258
AA Change: N497K

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000108883
Gene: ENSMUSG00000064293
AA Change: N497K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113260
SMART Domains Protein: ENSMUSP00000108885
Gene: ENSMUSG00000064293

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113261
SMART Domains Protein: ENSMUSP00000108886
Gene: ENSMUSG00000064293

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113264
SMART Domains Protein: ENSMUSP00000108889
Gene: ENSMUSG00000064293

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
FN3 700 786 8.39e0 SMART
FN3 801 886 1.33e-6 SMART
FN3 901 981 9.85e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132395
Meta Mutation Damage Score 0.1276 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the contactin family of immunoglobulins. Contactins are axon-associated cell adhesion molecules that function in neuronal network formation and plasticity. The encoded protein is a glycosylphosphatidylinositol-anchored neuronal membrane protein that may play a role in the formation of axon connections in the developing nervous system. Deletion or mutation of this gene may play a role in 3p deletion syndrome and autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit aberrant projection of olfactory axons to multiple glomeruli in the olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,269,524 L603* probably null Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4932438A13Rik A G 3: 37,030,061 I3876V possibly damaging Het
6430548M08Rik T C 8: 120,152,502 L213P probably damaging Het
Akap12 A G 10: 4,357,347 K1491E probably benign Het
Akr1c12 T A 13: 4,279,340 H6L probably benign Het
Ankrd50 C T 3: 38,452,496 C251Y probably benign Het
Calu T C 6: 29,361,711 S51P possibly damaging Het
Cdh10 A G 15: 18,964,249 T166A probably benign Het
Clip1 T C 5: 123,617,829 probably benign Het
Cspg4 T A 9: 56,886,123 C381S probably damaging Het
Cyp1a2 T C 9: 57,681,868 N221S probably benign Het
Dnaaf5 C T 5: 139,152,924 probably benign Het
Dnah7b A G 1: 46,137,485 D755G probably damaging Het
Dscam A T 16: 96,820,997 V418E probably damaging Het
Eefsec T A 6: 88,298,094 H296L probably benign Het
Elmo3 T C 8: 105,309,220 probably null Het
Gcm1 C T 9: 78,059,816 Q106* probably null Het
Gnl1 G T 17: 35,988,521 G528V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
H2-T23 A G 17: 36,030,643 V312A probably benign Het
Hectd4 C A 5: 121,303,525 probably benign Het
Hoxa7 T A 6: 52,216,626 probably benign Het
Ifnlr1 T A 4: 135,701,228 V122E probably damaging Het
Kcnt2 T C 1: 140,584,287 M1036T probably damaging Het
Khdc1b G T 1: 21,384,806 K96N probably damaging Het
Kif19a A T 11: 114,786,735 Y578F probably benign Het
Krt4 G A 15: 101,921,250 T281M probably benign Het
Lyl1 A C 8: 84,704,002 T178P probably damaging Het
March6 A G 15: 31,488,814 V317A probably benign Het
Mmp1b G A 9: 7,384,708 T280I possibly damaging Het
Mpi T C 9: 57,545,253 D332G probably damaging Het
Naip6 T C 13: 100,294,739 T1197A probably benign Het
Ntng2 G A 2: 29,204,277 L361F probably benign Het
Obscn A T 11: 59,132,547 I668N probably damaging Het
Olfr1090 A G 2: 86,754,181 S186P probably benign Het
Olfr686 A T 7: 105,203,955 C129* probably null Het
Pabpc1l A G 2: 164,042,327 E328G probably damaging Het
Pan3 A T 5: 147,450,730 N170Y probably damaging Het
Prdm2 C T 4: 143,131,815 R1635Q possibly damaging Het
Rassf6 G T 5: 90,604,326 Q258K possibly damaging Het
Ribc2 A G 15: 85,135,250 M78V probably benign Het
Rp9 A C 9: 22,449,858 H44Q probably damaging Het
Skint5 T A 4: 113,942,753 H73L probably damaging Het
Slc6a12 A T 6: 121,354,280 probably null Het
Smg6 G A 11: 74,929,541 G213R probably damaging Het
Spout1 A G 2: 30,174,136 V372A probably benign Het
Svep1 T A 4: 58,084,807 probably null Het
Tab1 T C 15: 80,153,740 L258P probably damaging Het
Tbl3 A G 17: 24,700,708 S791P possibly damaging Het
Tcof1 C A 18: 60,822,837 D927Y probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Topaz1 T C 9: 122,750,604 S860P possibly damaging Het
Vill T C 9: 119,068,431 I258T probably benign Het
Vmn1r204 G A 13: 22,556,844 R215H probably benign Het
Vmn2r106 A T 17: 20,267,651 F829I probably damaging Het
Vmn2r14 A T 5: 109,216,064 I662N probably damaging Het
Vmn2r58 A T 7: 41,864,461 F253I probably benign Het
Vps8 A T 16: 21,470,123 N411Y probably damaging Het
Zfp932 T A 5: 110,009,954 V506E probably benign Het
Other mutations in Cntn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cntn4 APN 6 106506225 missense probably damaging 1.00
IGL00725:Cntn4 APN 6 106662655 missense probably damaging 1.00
IGL01062:Cntn4 APN 6 106618278 splice site probably benign
IGL01432:Cntn4 APN 6 106678334 splice site probably benign
IGL01585:Cntn4 APN 6 106618328 nonsense probably null
IGL01710:Cntn4 APN 6 106550431 missense possibly damaging 0.87
IGL01870:Cntn4 APN 6 106489715 missense possibly damaging 0.95
IGL01933:Cntn4 APN 6 106694384 missense probably damaging 0.99
IGL01937:Cntn4 APN 6 106437904 missense probably damaging 1.00
IGL01945:Cntn4 APN 6 106437904 missense probably damaging 1.00
IGL02007:Cntn4 APN 6 106655529 missense probably benign 0.03
IGL02506:Cntn4 APN 6 106618388 missense probably benign 0.24
IGL02561:Cntn4 APN 6 106523509 missense probably damaging 1.00
IGL03080:Cntn4 APN 6 106655539 missense probably damaging 1.00
IGL03338:Cntn4 APN 6 106655589 missense probably damaging 0.98
IGL03097:Cntn4 UTSW 6 106353712 missense probably benign 0.10
LCD18:Cntn4 UTSW 6 106553940 intron probably benign
R0083:Cntn4 UTSW 6 106525369 missense possibly damaging 0.79
R0098:Cntn4 UTSW 6 106618424 splice site probably benign
R0501:Cntn4 UTSW 6 106618335 missense probably damaging 1.00
R0626:Cntn4 UTSW 6 106662578 missense probably benign 0.07
R0633:Cntn4 UTSW 6 106679248 splice site probably null
R0730:Cntn4 UTSW 6 106550486 missense probably damaging 1.00
R0849:Cntn4 UTSW 6 106667457 missense probably damaging 1.00
R0883:Cntn4 UTSW 6 106667540 splice site probably benign
R0926:Cntn4 UTSW 6 106655581 missense probably benign 0.21
R1199:Cntn4 UTSW 6 106353597 splice site probably benign
R1293:Cntn4 UTSW 6 106353724 missense probably benign 0.00
R1296:Cntn4 UTSW 6 106509402 missense probably damaging 1.00
R1344:Cntn4 UTSW 6 106344870 splice site probably null
R1418:Cntn4 UTSW 6 106344870 splice site probably null
R1660:Cntn4 UTSW 6 106679297 missense probably benign 0.35
R1751:Cntn4 UTSW 6 106618410 critical splice donor site probably null
R1883:Cntn4 UTSW 6 106679392 missense probably benign 0.01
R1884:Cntn4 UTSW 6 106679392 missense probably benign 0.01
R1899:Cntn4 UTSW 6 106675813 missense probably benign 0.21
R1906:Cntn4 UTSW 6 106353646 missense probably benign 0.00
R2048:Cntn4 UTSW 6 106437864 splice site probably benign
R2113:Cntn4 UTSW 6 106489697 missense probably damaging 1.00
R3177:Cntn4 UTSW 6 106437964 critical splice donor site probably null
R3277:Cntn4 UTSW 6 106437964 critical splice donor site probably null
R4401:Cntn4 UTSW 6 106489664 missense possibly damaging 0.94
R4540:Cntn4 UTSW 6 106675748 missense probably damaging 1.00
R4688:Cntn4 UTSW 6 106437949 missense probably damaging 1.00
R4697:Cntn4 UTSW 6 106525485 missense probably damaging 1.00
R4810:Cntn4 UTSW 6 106655611 missense probably benign 0.04
R4816:Cntn4 UTSW 6 106550497 missense probably benign
R4873:Cntn4 UTSW 6 106437913 missense possibly damaging 0.61
R4875:Cntn4 UTSW 6 106437913 missense possibly damaging 0.61
R4953:Cntn4 UTSW 6 106525418 missense probably benign 0.01
R5288:Cntn4 UTSW 6 106181804 missense possibly damaging 0.60
R5336:Cntn4 UTSW 6 106662634 missense possibly damaging 0.72
R5386:Cntn4 UTSW 6 106181804 missense possibly damaging 0.60
R5477:Cntn4 UTSW 6 106673950 missense possibly damaging 0.88
R5514:Cntn4 UTSW 6 106672883 missense probably damaging 1.00
R5668:Cntn4 UTSW 6 106679436 splice site silent
R6334:Cntn4 UTSW 6 106344786 missense probably benign
R6334:Cntn4 UTSW 6 106506192 missense probably benign 0.29
R6904:Cntn4 UTSW 6 106697583 missense probably benign 0.03
R6985:Cntn4 UTSW 6 106679417 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CGAGGCTGTCAAATGATGTAAC -3'
(R):5'- CGATGCTGAAATAAGATAGCCTTTC -3'

Sequencing Primer
(F):5'- AGTTTCTCACGAGATAAACATCAC -3'
(R):5'- GCCTTTCAATCATATTCATTACCAAC -3'
Posted On2015-04-17