Incidental Mutation 'R3944:Vmn2r58'
ID307593
Institutional Source Beutler Lab
Gene Symbol Vmn2r58
Ensembl Gene ENSMUSG00000090383
Gene Namevomeronasal 2, receptor 58
SynonymsEG628422
MMRRC Submission 040925-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R3944 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location41836881-41872670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41864461 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 253 (F253I)
Ref Sequence ENSEMBL: ENSMUSP00000126966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171671]
Predicted Effect probably benign
Transcript: ENSMUST00000171671
AA Change: F253I

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000126966
Gene: ENSMUSG00000090383
AA Change: F253I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 8e-43 PFAM
Pfam:NCD3G 514 567 1.8e-23 PFAM
Pfam:7tm_3 597 835 2.9e-52 PFAM
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,269,524 L603* probably null Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4932438A13Rik A G 3: 37,030,061 I3876V possibly damaging Het
6430548M08Rik T C 8: 120,152,502 L213P probably damaging Het
Akap12 A G 10: 4,357,347 K1491E probably benign Het
Akr1c12 T A 13: 4,279,340 H6L probably benign Het
Ankrd50 C T 3: 38,452,496 C251Y probably benign Het
Calu T C 6: 29,361,711 S125P possibly damaging Het
Cdh10 A G 15: 18,964,249 T166A probably benign Het
Clip1 T C 5: 123,617,829 probably benign Het
Cntn4 T G 6: 106,618,414 N497K probably benign Het
Cspg4 T A 9: 56,886,123 C381S probably damaging Het
Cyp1a2 T C 9: 57,681,868 N221S probably benign Het
Dnaaf5 C T 5: 139,152,924 probably benign Het
Dnah7b A G 1: 46,137,485 D755G probably damaging Het
Dscam A T 16: 96,820,997 V418E probably damaging Het
Eefsec T A 6: 88,298,094 H296L probably benign Het
Elmo3 T C 8: 105,309,220 probably null Het
Gcm1 C T 9: 78,059,816 Q106* probably null Het
Gnl1 G T 17: 35,988,521 G528V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
H2-T23 A G 17: 36,030,643 V312A probably benign Het
Hectd4 C A 5: 121,303,525 probably benign Het
Hoxa7 T A 6: 52,216,626 probably benign Het
Ifnlr1 T A 4: 135,701,228 V122E probably damaging Het
Kcnt2 T C 1: 140,584,287 M1036T probably damaging Het
Khdc1b G T 1: 21,384,806 K96N probably damaging Het
Kif19a A T 11: 114,786,735 Y578F probably benign Het
Krt4 G A 15: 101,921,250 T281M probably benign Het
Lyl1 A C 8: 84,704,002 T178P probably damaging Het
March6 A G 15: 31,488,814 V317A probably benign Het
Mmp1b G A 9: 7,384,708 T280I possibly damaging Het
Mpi T C 9: 57,545,253 D332G probably damaging Het
Naip6 T C 13: 100,294,739 T1197A probably benign Het
Ntng2 G A 2: 29,204,277 L361F probably benign Het
Obscn A T 11: 59,132,547 I668N probably damaging Het
Olfr1090 A G 2: 86,754,181 S186P probably benign Het
Olfr686 A T 7: 105,203,955 C129* probably null Het
Pabpc1l A G 2: 164,042,327 E328G probably damaging Het
Pan3 A T 5: 147,450,730 N170Y probably damaging Het
Prdm2 C T 4: 143,131,815 R1635Q possibly damaging Het
Rassf6 G T 5: 90,604,326 Q258K possibly damaging Het
Ribc2 A G 15: 85,135,250 M78V probably benign Het
Rp9 A C 9: 22,449,858 H44Q probably damaging Het
Skint5 T A 4: 113,942,753 H73L probably damaging Het
Slc6a12 A T 6: 121,354,280 probably null Het
Smg6 G A 11: 74,929,541 G213R probably damaging Het
Spout1 A G 2: 30,174,136 V372A probably benign Het
Svep1 T A 4: 58,084,807 probably null Het
Tab1 T C 15: 80,153,740 L258P probably damaging Het
Tbl3 A G 17: 24,700,708 S791P possibly damaging Het
Tcof1 C A 18: 60,822,837 D927Y probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Topaz1 T C 9: 122,750,604 S860P possibly damaging Het
Vill T C 9: 119,068,431 I258T probably benign Het
Vmn1r204 G A 13: 22,556,844 R215H probably benign Het
Vmn2r106 A T 17: 20,267,651 F829I probably damaging Het
Vmn2r14 A T 5: 109,216,064 I662N probably damaging Het
Vps8 A T 16: 21,470,123 N411Y probably damaging Het
Zfp932 T A 5: 110,009,954 V506E probably benign Het
Other mutations in Vmn2r58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Vmn2r58 APN 7 41864430 missense possibly damaging 0.53
IGL00924:Vmn2r58 APN 7 41837467 missense probably damaging 1.00
IGL01291:Vmn2r58 APN 7 41864511 missense probably benign 0.02
IGL01480:Vmn2r58 APN 7 41864692 missense probably benign 0.01
IGL01551:Vmn2r58 APN 7 41865279 missense probably damaging 0.97
IGL01591:Vmn2r58 APN 7 41865329 missense probably benign 0.03
IGL01940:Vmn2r58 APN 7 41837647 missense probably benign 0.00
IGL01994:Vmn2r58 APN 7 41836970 missense probably damaging 0.98
IGL02041:Vmn2r58 APN 7 41865279 missense probably damaging 0.97
IGL02222:Vmn2r58 APN 7 41864025 missense possibly damaging 0.81
IGL02317:Vmn2r58 APN 7 41837341 missense possibly damaging 0.89
IGL02614:Vmn2r58 APN 7 41837129 missense probably damaging 1.00
IGL02673:Vmn2r58 APN 7 41864658 missense possibly damaging 0.90
IGL03323:Vmn2r58 APN 7 41861871 missense probably benign 0.06
IGL03337:Vmn2r58 APN 7 41864386 missense possibly damaging 0.93
IGL03380:Vmn2r58 APN 7 41864450 missense probably benign 0.00
ANU05:Vmn2r58 UTSW 7 41864511 missense probably benign 0.02
R0138:Vmn2r58 UTSW 7 41837624 missense probably damaging 1.00
R0141:Vmn2r58 UTSW 7 41861885 missense probably benign 0.11
R0421:Vmn2r58 UTSW 7 41865204 missense probably benign 0.02
R0604:Vmn2r58 UTSW 7 41860576 missense possibly damaging 0.78
R0854:Vmn2r58 UTSW 7 41837138 missense probably damaging 1.00
R1413:Vmn2r58 UTSW 7 41863963 missense probably benign 0.01
R1441:Vmn2r58 UTSW 7 41837440 missense probably damaging 1.00
R1678:Vmn2r58 UTSW 7 41864056 missense probably benign 0.40
R1691:Vmn2r58 UTSW 7 41837489 missense possibly damaging 0.95
R1699:Vmn2r58 UTSW 7 41860527 missense probably benign
R1865:Vmn2r58 UTSW 7 41837258 missense possibly damaging 0.95
R2008:Vmn2r58 UTSW 7 41860500 missense probably damaging 1.00
R2036:Vmn2r58 UTSW 7 41863993 missense probably benign
R2202:Vmn2r58 UTSW 7 41864170 missense probably benign 0.07
R3787:Vmn2r58 UTSW 7 41864074 missense probably benign 0.01
R3883:Vmn2r58 UTSW 7 41864490 nonsense probably null
R3949:Vmn2r58 UTSW 7 41863924 missense probably benign 0.08
R4232:Vmn2r58 UTSW 7 41837587 missense possibly damaging 0.91
R4409:Vmn2r58 UTSW 7 41872627 missense possibly damaging 0.69
R4411:Vmn2r58 UTSW 7 41861936 missense possibly damaging 0.85
R4413:Vmn2r58 UTSW 7 41861936 missense possibly damaging 0.85
R4600:Vmn2r58 UTSW 7 41872622 missense probably benign 0.03
R4610:Vmn2r58 UTSW 7 41837693 missense probably benign
R4646:Vmn2r58 UTSW 7 41860511 missense probably damaging 0.96
R4793:Vmn2r58 UTSW 7 41865071 missense probably damaging 0.99
R4870:Vmn2r58 UTSW 7 41837215 missense possibly damaging 0.76
R4981:Vmn2r58 UTSW 7 41837461 missense probably damaging 1.00
R4993:Vmn2r58 UTSW 7 41837752 missense probably benign 0.00
R5024:Vmn2r58 UTSW 7 41864322 missense probably damaging 0.99
R5064:Vmn2r58 UTSW 7 41837110 missense probably damaging 0.99
R5330:Vmn2r58 UTSW 7 41863960 nonsense probably null
R5526:Vmn2r58 UTSW 7 41872645 missense probably benign 0.01
R5980:Vmn2r58 UTSW 7 41865056 missense possibly damaging 0.81
R6163:Vmn2r58 UTSW 7 41837401 missense probably benign 0.31
R6365:Vmn2r58 UTSW 7 41864183 missense probably benign 0.42
R6567:Vmn2r58 UTSW 7 41865249 missense probably benign 0.34
R6594:Vmn2r58 UTSW 7 41837111 missense possibly damaging 0.69
R6980:Vmn2r58 UTSW 7 41864238 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TGGGTATCAACATCCCATGAAG -3'
(R):5'- TTCTATCTTGAATGACCGAGGTC -3'

Sequencing Primer
(F):5'- GGTATCAACATCCCATGAAGAGCTC -3'
(R):5'- AAGGACACATCTCTGTCGCTTG -3'
Posted On2015-04-17