Incidental Mutation 'R3944:Mmp1b'
ID307599
Institutional Source Beutler Lab
Gene Symbol Mmp1b
Ensembl Gene ENSMUSG00000041620
Gene Namematrix metallopeptidase 1b (interstitial collagenase)
SynonymsMcol-B
MMRRC Submission 040925-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R3944 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location7368239-7388047 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 7384708 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 280 (T280I)
Ref Sequence ENSEMBL: ENSMUSP00000047261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047888]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047888
AA Change: T280I

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047261
Gene: ENSMUSG00000041620
AA Change: T280I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:PG_binding_1 26 84 1.4e-13 PFAM
ZnMc 102 260 3.08e-46 SMART
HX 281 323 4.39e-2 SMART
HX 325 369 3.51e-10 SMART
HX 374 421 1.03e-16 SMART
HX 423 463 1.6e0 SMART
Meta Mutation Damage Score 0.146 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,269,524 L603* probably null Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4932438A13Rik A G 3: 37,030,061 I3876V possibly damaging Het
6430548M08Rik T C 8: 120,152,502 L213P probably damaging Het
Akap12 A G 10: 4,357,347 K1491E probably benign Het
Akr1c12 T A 13: 4,279,340 H6L probably benign Het
Ankrd50 C T 3: 38,452,496 C251Y probably benign Het
Calu T C 6: 29,361,711 S125P possibly damaging Het
Cdh10 A G 15: 18,964,249 T166A probably benign Het
Clip1 T C 5: 123,617,829 probably benign Het
Cntn4 T G 6: 106,618,414 N497K probably benign Het
Cspg4 T A 9: 56,886,123 C381S probably damaging Het
Cyp1a2 T C 9: 57,681,868 N221S probably benign Het
Dnaaf5 C T 5: 139,152,924 probably benign Het
Dnah7b A G 1: 46,137,485 D755G probably damaging Het
Dscam A T 16: 96,820,997 V418E probably damaging Het
Eefsec T A 6: 88,298,094 H296L probably benign Het
Elmo3 T C 8: 105,309,220 probably null Het
Gcm1 C T 9: 78,059,816 Q106* probably null Het
Gnl1 G T 17: 35,988,521 G528V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
H2-T23 A G 17: 36,030,643 V312A probably benign Het
Hectd4 C A 5: 121,303,525 probably benign Het
Hoxa7 T A 6: 52,216,626 probably benign Het
Ifnlr1 T A 4: 135,701,228 V122E probably damaging Het
Kcnt2 T C 1: 140,584,287 M1036T probably damaging Het
Khdc1b G T 1: 21,384,806 K96N probably damaging Het
Kif19a A T 11: 114,786,735 Y578F probably benign Het
Krt4 G A 15: 101,921,250 T281M probably benign Het
Lyl1 A C 8: 84,704,002 T178P probably damaging Het
March6 A G 15: 31,488,814 V317A probably benign Het
Mpi T C 9: 57,545,253 D332G probably damaging Het
Naip6 T C 13: 100,294,739 T1197A probably benign Het
Ntng2 G A 2: 29,204,277 L361F probably benign Het
Obscn A T 11: 59,132,547 I668N probably damaging Het
Olfr1090 A G 2: 86,754,181 S186P probably benign Het
Olfr686 A T 7: 105,203,955 C129* probably null Het
Pabpc1l A G 2: 164,042,327 E328G probably damaging Het
Pan3 A T 5: 147,450,730 N170Y probably damaging Het
Prdm2 C T 4: 143,131,815 R1635Q possibly damaging Het
Rassf6 G T 5: 90,604,326 Q258K possibly damaging Het
Ribc2 A G 15: 85,135,250 M78V probably benign Het
Rp9 A C 9: 22,449,858 H44Q probably damaging Het
Skint5 T A 4: 113,942,753 H73L probably damaging Het
Slc6a12 A T 6: 121,354,280 probably null Het
Smg6 G A 11: 74,929,541 G213R probably damaging Het
Spout1 A G 2: 30,174,136 V372A probably benign Het
Svep1 T A 4: 58,084,807 probably null Het
Tab1 T C 15: 80,153,740 L258P probably damaging Het
Tbl3 A G 17: 24,700,708 S791P possibly damaging Het
Tcof1 C A 18: 60,822,837 D927Y probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Topaz1 T C 9: 122,750,604 S860P possibly damaging Het
Vill T C 9: 119,068,431 I258T probably benign Het
Vmn1r204 G A 13: 22,556,844 R215H probably benign Het
Vmn2r106 A T 17: 20,267,651 F829I probably damaging Het
Vmn2r14 A T 5: 109,216,064 I662N probably damaging Het
Vmn2r58 A T 7: 41,864,461 F253I probably benign Het
Vps8 A T 16: 21,470,123 N411Y probably damaging Het
Zfp932 T A 5: 110,009,954 V506E probably benign Het
Other mutations in Mmp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Mmp1b APN 9 7387946 missense probably benign 0.00
IGL00339:Mmp1b APN 9 7368304 missense probably benign 0.19
IGL00832:Mmp1b APN 9 7387023 missense possibly damaging 0.81
IGL01110:Mmp1b APN 9 7384921 missense probably benign 0.02
IGL02121:Mmp1b APN 9 7384935 missense probably benign 0.22
IGL02143:Mmp1b APN 9 7386400 missense probably benign 0.10
IGL02698:Mmp1b APN 9 7384877 missense probably damaging 1.00
IGL02928:Mmp1b APN 9 7368242 makesense probably null
IGL03218:Mmp1b APN 9 7387907 missense probably benign 0.07
IGL03304:Mmp1b APN 9 7384701 missense probably damaging 1.00
IGL02802:Mmp1b UTSW 9 7384709 missense probably benign 0.08
R0122:Mmp1b UTSW 9 7386689 missense probably damaging 0.99
R0506:Mmp1b UTSW 9 7387013 missense possibly damaging 0.52
R0600:Mmp1b UTSW 9 7387947 missense possibly damaging 0.55
R1454:Mmp1b UTSW 9 7386693 missense probably damaging 1.00
R1466:Mmp1b UTSW 9 7384779 splice site probably benign
R1696:Mmp1b UTSW 9 7386699 missense probably damaging 0.99
R1837:Mmp1b UTSW 9 7386409 missense probably damaging 1.00
R1986:Mmp1b UTSW 9 7368577 missense probably benign 0.01
R2031:Mmp1b UTSW 9 7368607 missense possibly damaging 0.68
R2098:Mmp1b UTSW 9 7386984 missense probably benign 0.03
R2107:Mmp1b UTSW 9 7369310 missense probably damaging 1.00
R2847:Mmp1b UTSW 9 7370763 missense probably benign 0.05
R2870:Mmp1b UTSW 9 7386875 synonymous silent
R4654:Mmp1b UTSW 9 7370849 missense probably benign 0.18
R4829:Mmp1b UTSW 9 7370729 critical splice donor site probably null
R5329:Mmp1b UTSW 9 7384897 missense possibly damaging 0.61
R5332:Mmp1b UTSW 9 7384897 missense possibly damaging 0.61
R5333:Mmp1b UTSW 9 7384897 missense possibly damaging 0.61
R5418:Mmp1b UTSW 9 7384897 missense possibly damaging 0.61
R5419:Mmp1b UTSW 9 7384897 missense possibly damaging 0.61
R5420:Mmp1b UTSW 9 7384897 missense possibly damaging 0.61
R6053:Mmp1b UTSW 9 7385031 missense probably benign 0.07
R6394:Mmp1b UTSW 9 7386316 missense probably benign 0.20
R6774:Mmp1b UTSW 9 7387914 missense probably benign 0.00
R6842:Mmp1b UTSW 9 7384888 missense probably damaging 1.00
R7092:Mmp1b UTSW 9 7386981 missense not run
R7146:Mmp1b UTSW 9 7385014 missense not run
Predicted Primers PCR Primer
(F):5'- GTTGACCAGATGGAAAATCAGAATC -3'
(R):5'- ATCGCATCCAGGCCTTATATGG -3'

Sequencing Primer
(F):5'- TAAGTTGTAAAAATGAAGAGAGAGGG -3'
(R):5'- CCAGGCCTTATATGGTAAGTGAACC -3'
Posted On2015-04-17