Incidental Mutation 'R3944:Rp9'
ID307600
Institutional Source Beutler Lab
Gene Symbol Rp9
Ensembl Gene ENSMUSG00000032239
Gene Nameretinitis pigmentosa 9 (human)
SynonymsRp9h, PAP-1
MMRRC Submission 040925-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.821) question?
Stock #R3944 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location22411047-22469743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 22449858 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 44 (H44Q)
Ref Sequence ENSEMBL: ENSMUSP00000150554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034763] [ENSMUST00000168332] [ENSMUST00000215715] [ENSMUST00000216973]
Predicted Effect probably damaging
Transcript: ENSMUST00000034763
AA Change: H129Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034763
Gene: ENSMUSG00000032239
AA Change: H129Q

DomainStartEndE-ValueType
low complexity region 19 28 N/A INTRINSIC
ZnF_C2HC 96 114 5.17e0 SMART
low complexity region 161 213 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168332
Predicted Effect possibly damaging
Transcript: ENSMUST00000215715
AA Change: H129Q

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000216973
AA Change: H44Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217370
Meta Mutation Damage Score 0.226 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can be bound and phosphorylated by the protooncogene PIM1 product, a serine/threonine protein kinase . This protein localizes in nuclear speckles containing the splicing factors, and has a role in pre-mRNA splicing. CBF1-interacting protein (CIR), a corepressor of CBF1, can also bind to this protein and effects alternative splicing. Mutations in this gene result in autosomal dominant retinitis pigmentosa-9. This gene has a pseudogene (GeneID: 441212), which is located in tandem array approximately 166 kb distal to this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,269,524 L603* probably null Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4932438A13Rik A G 3: 37,030,061 I3876V possibly damaging Het
6430548M08Rik T C 8: 120,152,502 L213P probably damaging Het
Akap12 A G 10: 4,357,347 K1491E probably benign Het
Akr1c12 T A 13: 4,279,340 H6L probably benign Het
Ankrd50 C T 3: 38,452,496 C251Y probably benign Het
Calu T C 6: 29,361,711 S125P possibly damaging Het
Cdh10 A G 15: 18,964,249 T166A probably benign Het
Clip1 T C 5: 123,617,829 probably benign Het
Cntn4 T G 6: 106,618,414 N497K probably benign Het
Cspg4 T A 9: 56,886,123 C381S probably damaging Het
Cyp1a2 T C 9: 57,681,868 N221S probably benign Het
Dnaaf5 C T 5: 139,152,924 probably benign Het
Dnah7b A G 1: 46,137,485 D755G probably damaging Het
Dscam A T 16: 96,820,997 V418E probably damaging Het
Eefsec T A 6: 88,298,094 H296L probably benign Het
Elmo3 T C 8: 105,309,220 probably null Het
Gcm1 C T 9: 78,059,816 Q106* probably null Het
Gnl1 G T 17: 35,988,521 G528V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
H2-T23 A G 17: 36,030,643 V312A probably benign Het
Hectd4 C A 5: 121,303,525 probably benign Het
Hoxa7 T A 6: 52,216,626 probably benign Het
Ifnlr1 T A 4: 135,701,228 V122E probably damaging Het
Kcnt2 T C 1: 140,584,287 M1036T probably damaging Het
Khdc1b G T 1: 21,384,806 K96N probably damaging Het
Kif19a A T 11: 114,786,735 Y578F probably benign Het
Krt4 G A 15: 101,921,250 T281M probably benign Het
Lyl1 A C 8: 84,704,002 T178P probably damaging Het
March6 A G 15: 31,488,814 V317A probably benign Het
Mmp1b G A 9: 7,384,708 T280I possibly damaging Het
Mpi T C 9: 57,545,253 D332G probably damaging Het
Naip6 T C 13: 100,294,739 T1197A probably benign Het
Ntng2 G A 2: 29,204,277 L361F probably benign Het
Obscn A T 11: 59,132,547 I668N probably damaging Het
Olfr1090 A G 2: 86,754,181 S186P probably benign Het
Olfr686 A T 7: 105,203,955 C129* probably null Het
Pabpc1l A G 2: 164,042,327 E328G probably damaging Het
Pan3 A T 5: 147,450,730 N170Y probably damaging Het
Prdm2 C T 4: 143,131,815 R1635Q possibly damaging Het
Rassf6 G T 5: 90,604,326 Q258K possibly damaging Het
Ribc2 A G 15: 85,135,250 M78V probably benign Het
Skint5 T A 4: 113,942,753 H73L probably damaging Het
Slc6a12 A T 6: 121,354,280 probably null Het
Smg6 G A 11: 74,929,541 G213R probably damaging Het
Spout1 A G 2: 30,174,136 V372A probably benign Het
Svep1 T A 4: 58,084,807 probably null Het
Tab1 T C 15: 80,153,740 L258P probably damaging Het
Tbl3 A G 17: 24,700,708 S791P possibly damaging Het
Tcof1 C A 18: 60,822,837 D927Y probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Topaz1 T C 9: 122,750,604 S860P possibly damaging Het
Vill T C 9: 119,068,431 I258T probably benign Het
Vmn1r204 G A 13: 22,556,844 R215H probably benign Het
Vmn2r106 A T 17: 20,267,651 F829I probably damaging Het
Vmn2r14 A T 5: 109,216,064 I662N probably damaging Het
Vmn2r58 A T 7: 41,864,461 F253I probably benign Het
Vps8 A T 16: 21,470,123 N411Y probably damaging Het
Zfp932 T A 5: 110,009,954 V506E probably benign Het
Other mutations in Rp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03210:Rp9 APN 9 22457428 missense probably benign 0.40
R0512:Rp9 UTSW 9 22458719 missense probably benign 0.00
R1157:Rp9 UTSW 9 22458740 missense probably damaging 1.00
R1500:Rp9 UTSW 9 22457455 missense probably damaging 1.00
R1677:Rp9 UTSW 9 22453801 missense probably damaging 0.99
R2135:Rp9 UTSW 9 22468129 missense possibly damaging 0.68
R5747:Rp9 UTSW 9 22448664 intron probably benign
R5853:Rp9 UTSW 9 22448769 intron probably benign
R6342:Rp9 UTSW 9 22449858 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCAGACTTCAAGAGGACATTGG -3'
(R):5'- ATCTATCATCAAGCTACAGGAAGC -3'

Sequencing Primer
(F):5'- CAGCCTAGTCTACAGAGTGAGTTC -3'
(R):5'- GAGCTCCATTGCCAGTTTGAAGC -3'
Posted On2015-04-17