Incidental Mutation 'R3944:Mpi'
ID307602
Institutional Source Beutler Lab
Gene Symbol Mpi
Ensembl Gene ENSMUSG00000032306
Gene Namemannose phosphate isomerase
Synonyms1110002E17Rik, Mpi-1, Mpi1
MMRRC Submission 040925-MU
Accession Numbers

Genbank: NM_025837; MGI: 97075

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3944 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location57544256-57552763 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57545253 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 332 (D332G)
Ref Sequence ENSEMBL: ENSMUSP00000034856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034856] [ENSMUST00000093833] [ENSMUST00000114200]
Predicted Effect probably damaging
Transcript: ENSMUST00000034856
AA Change: D332G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034856
Gene: ENSMUSG00000032306
AA Change: D332G

DomainStartEndE-ValueType
Pfam:PMI_typeI 6 384 4.3e-145 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093833
SMART Domains Protein: ENSMUSP00000091353
Gene: ENSMUSG00000032305

DomainStartEndE-ValueType
Pfam:FAM219A 72 128 4.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114200
SMART Domains Protein: ENSMUSP00000109838
Gene: ENSMUSG00000032305

DomainStartEndE-ValueType
Pfam:FAM219A 72 197 1.6e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140671
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145543
Predicted Effect probably benign
Transcript: ENSMUST00000156428
SMART Domains Protein: ENSMUSP00000119342
Gene: ENSMUSG00000032306

DomainStartEndE-ValueType
Pfam:PMI_typeI 3 119 3.1e-45 PFAM
Meta Mutation Damage Score 0.208 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphomannose isomerase catalyzes the interconversion of fructose-6-phosphate and mannose-6-phosphate and plays a critical role in maintaining the supply of D-mannose derivatives, which are required for most glycosylation reactions. Mutations in the MPI gene were found in patients with carbohydrate-deficient glycoprotein syndrome, type Ib. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, variable abnormalities of the yolk sac and embryonic vasculature, and partial penetrance of abnormal chorioallantoic fusion, placental defects, impaired emrbyo turning, increased apoptosis, and posterior axial truncations. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,269,524 L603* probably null Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4932438A13Rik A G 3: 37,030,061 I3876V possibly damaging Het
6430548M08Rik T C 8: 120,152,502 L213P probably damaging Het
Akap12 A G 10: 4,357,347 K1491E probably benign Het
Akr1c12 T A 13: 4,279,340 H6L probably benign Het
Ankrd50 C T 3: 38,452,496 C251Y probably benign Het
Calu T C 6: 29,361,711 S125P possibly damaging Het
Cdh10 A G 15: 18,964,249 T166A probably benign Het
Clip1 T C 5: 123,617,829 probably benign Het
Cntn4 T G 6: 106,618,414 N497K probably benign Het
Cspg4 T A 9: 56,886,123 C381S probably damaging Het
Cyp1a2 T C 9: 57,681,868 N221S probably benign Het
Dnaaf5 C T 5: 139,152,924 probably benign Het
Dnah7b A G 1: 46,137,485 D755G probably damaging Het
Dscam A T 16: 96,820,997 V418E probably damaging Het
Eefsec T A 6: 88,298,094 H296L probably benign Het
Elmo3 T C 8: 105,309,220 probably null Het
Gcm1 C T 9: 78,059,816 Q106* probably null Het
Gnl1 G T 17: 35,988,521 G528V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
H2-T23 A G 17: 36,030,643 V312A probably benign Het
Hectd4 C A 5: 121,303,525 probably benign Het
Hoxa7 T A 6: 52,216,626 probably benign Het
Ifnlr1 T A 4: 135,701,228 V122E probably damaging Het
Kcnt2 T C 1: 140,584,287 M1036T probably damaging Het
Khdc1b G T 1: 21,384,806 K96N probably damaging Het
Kif19a A T 11: 114,786,735 Y578F probably benign Het
Krt4 G A 15: 101,921,250 T281M probably benign Het
Lyl1 A C 8: 84,704,002 T178P probably damaging Het
March6 A G 15: 31,488,814 V317A probably benign Het
Mmp1b G A 9: 7,384,708 T280I possibly damaging Het
Naip6 T C 13: 100,294,739 T1197A probably benign Het
Ntng2 G A 2: 29,204,277 L361F probably benign Het
Obscn A T 11: 59,132,547 I668N probably damaging Het
Olfr1090 A G 2: 86,754,181 S186P probably benign Het
Olfr686 A T 7: 105,203,955 C129* probably null Het
Pabpc1l A G 2: 164,042,327 E328G probably damaging Het
Pan3 A T 5: 147,450,730 N170Y probably damaging Het
Prdm2 C T 4: 143,131,815 R1635Q possibly damaging Het
Rassf6 G T 5: 90,604,326 Q258K possibly damaging Het
Ribc2 A G 15: 85,135,250 M78V probably benign Het
Rp9 A C 9: 22,449,858 H44Q probably damaging Het
Skint5 T A 4: 113,942,753 H73L probably damaging Het
Slc6a12 A T 6: 121,354,280 probably null Het
Smg6 G A 11: 74,929,541 G213R probably damaging Het
Spout1 A G 2: 30,174,136 V372A probably benign Het
Svep1 T A 4: 58,084,807 probably null Het
Tab1 T C 15: 80,153,740 L258P probably damaging Het
Tbl3 A G 17: 24,700,708 S791P possibly damaging Het
Tcof1 C A 18: 60,822,837 D927Y probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Topaz1 T C 9: 122,750,604 S860P possibly damaging Het
Vill T C 9: 119,068,431 I258T probably benign Het
Vmn1r204 G A 13: 22,556,844 R215H probably benign Het
Vmn2r106 A T 17: 20,267,651 F829I probably damaging Het
Vmn2r14 A T 5: 109,216,064 I662N probably damaging Het
Vmn2r58 A T 7: 41,864,461 F253I probably benign Het
Vps8 A T 16: 21,470,123 N411Y probably damaging Het
Zfp932 T A 5: 110,009,954 V506E probably benign Het
Other mutations in Mpi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Mpi APN 9 57552266 missense probably damaging 1.00
IGL01071:Mpi APN 9 57550592 missense probably damaging 1.00
IGL01604:Mpi APN 9 57550742 missense possibly damaging 0.85
IGL02090:Mpi APN 9 57550653 missense probably benign 0.00
benadryl UTSW 9 57550757 missense probably damaging 1.00
zyrtec UTSW 9 57545217 missense probably damaging 1.00
F6893:Mpi UTSW 9 57546549 missense probably benign 0.12
R0751:Mpi UTSW 9 57550614 missense probably damaging 1.00
R1146:Mpi UTSW 9 57545189 unclassified probably benign
R3727:Mpi UTSW 9 57544849 missense possibly damaging 0.69
R4645:Mpi UTSW 9 57550757 missense probably damaging 1.00
R4772:Mpi UTSW 9 57544898 missense probably damaging 1.00
R4856:Mpi UTSW 9 57545307 missense probably damaging 1.00
R5088:Mpi UTSW 9 57550604 missense probably damaging 0.97
R5504:Mpi UTSW 9 57545217 missense probably damaging 1.00
R5886:Mpi UTSW 9 57548462 unclassified probably benign
R7038:Mpi UTSW 9 57545217 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTACGAAGGCCCACATCTG -3'
(R):5'- GGCGTACTTCACCATCTTATTACATG -3'

Sequencing Primer
(F):5'- ATCTGGTCCCTGGCAGAGAG -3'
(R):5'- GACATTTCTCTGTCTCTAGACTGCG -3'
Posted On2015-04-17