Incidental Mutation 'R3944:2610507B11Rik'
ID307610
Institutional Source Beutler Lab
Gene Symbol 2610507B11Rik
Ensembl Gene ENSMUSG00000010277
Gene NameRIKEN cDNA 2610507B11 gene
SynonymsD11Bhm178e, D11Bhm179e, E1
MMRRC Submission 040925-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R3944 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location78261752-78290623 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 78269524 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 603 (L603*)
Ref Sequence ENSEMBL: ENSMUSP00000010421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010421]
Predicted Effect probably null
Transcript: ENSMUST00000010421
AA Change: L603*
SMART Domains Protein: ENSMUSP00000010421
Gene: ENSMUSG00000010277
AA Change: L603*

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
Pfam:Fmp27 26 475 1.6e-45 PFAM
Pfam:Fmp27 446 674 3.2e-24 PFAM
low complexity region 719 734 N/A INTRINSIC
low complexity region 785 798 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
Fmp27_GFWDK 1028 1160 3.01e-61 SMART
low complexity region 1415 1421 N/A INTRINSIC
low complexity region 1690 1701 N/A INTRINSIC
Pfam:Apt1 1703 2176 2.4e-112 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136184
Predicted Effect probably benign
Transcript: ENSMUST00000145145
SMART Domains Protein: ENSMUSP00000119105
Gene: ENSMUSG00000010277

DomainStartEndE-ValueType
Pfam:Fmp27_GFWDK 1 52 1.2e-20 PFAM
Meta Mutation Damage Score 0.6476 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4932438A13Rik A G 3: 37,030,061 I3876V possibly damaging Het
6430548M08Rik T C 8: 120,152,502 L213P probably damaging Het
Akap12 A G 10: 4,357,347 K1491E probably benign Het
Akr1c12 T A 13: 4,279,340 H6L probably benign Het
Ankrd50 C T 3: 38,452,496 C251Y probably benign Het
Calu T C 6: 29,361,711 S125P possibly damaging Het
Cdh10 A G 15: 18,964,249 T166A probably benign Het
Clip1 T C 5: 123,617,829 probably benign Het
Cntn4 T G 6: 106,618,414 N497K probably benign Het
Cspg4 T A 9: 56,886,123 C381S probably damaging Het
Cyp1a2 T C 9: 57,681,868 N221S probably benign Het
Dnaaf5 C T 5: 139,152,924 probably benign Het
Dnah7b A G 1: 46,137,485 D755G probably damaging Het
Dscam A T 16: 96,820,997 V418E probably damaging Het
Eefsec T A 6: 88,298,094 H296L probably benign Het
Elmo3 T C 8: 105,309,220 probably null Het
Gcm1 C T 9: 78,059,816 Q106* probably null Het
Gnl1 G T 17: 35,988,521 G528V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
H2-T23 A G 17: 36,030,643 V312A probably benign Het
Hectd4 C A 5: 121,303,525 probably benign Het
Hoxa7 T A 6: 52,216,626 probably benign Het
Ifnlr1 T A 4: 135,701,228 V122E probably damaging Het
Kcnt2 T C 1: 140,584,287 M1036T probably damaging Het
Khdc1b G T 1: 21,384,806 K96N probably damaging Het
Kif19a A T 11: 114,786,735 Y578F probably benign Het
Krt4 G A 15: 101,921,250 T281M probably benign Het
Lyl1 A C 8: 84,704,002 T178P probably damaging Het
March6 A G 15: 31,488,814 V317A probably benign Het
Mmp1b G A 9: 7,384,708 T280I possibly damaging Het
Mpi T C 9: 57,545,253 D332G probably damaging Het
Naip6 T C 13: 100,294,739 T1197A probably benign Het
Ntng2 G A 2: 29,204,277 L361F probably benign Het
Obscn A T 11: 59,132,547 I668N probably damaging Het
Olfr1090 A G 2: 86,754,181 S186P probably benign Het
Olfr686 A T 7: 105,203,955 C129* probably null Het
Pabpc1l A G 2: 164,042,327 E328G probably damaging Het
Pan3 A T 5: 147,450,730 N170Y probably damaging Het
Prdm2 C T 4: 143,131,815 R1635Q possibly damaging Het
Rassf6 G T 5: 90,604,326 Q258K possibly damaging Het
Ribc2 A G 15: 85,135,250 M78V probably benign Het
Rp9 A C 9: 22,449,858 H44Q probably damaging Het
Skint5 T A 4: 113,942,753 H73L probably damaging Het
Slc6a12 A T 6: 121,354,280 probably null Het
Smg6 G A 11: 74,929,541 G213R probably damaging Het
Spout1 A G 2: 30,174,136 V372A probably benign Het
Svep1 T A 4: 58,084,807 probably null Het
Tab1 T C 15: 80,153,740 L258P probably damaging Het
Tbl3 A G 17: 24,700,708 S791P possibly damaging Het
Tcof1 C A 18: 60,822,837 D927Y probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Topaz1 T C 9: 122,750,604 S860P possibly damaging Het
Vill T C 9: 119,068,431 I258T probably benign Het
Vmn1r204 G A 13: 22,556,844 R215H probably benign Het
Vmn2r106 A T 17: 20,267,651 F829I probably damaging Het
Vmn2r14 A T 5: 109,216,064 I662N probably damaging Het
Vmn2r58 A T 7: 41,864,461 F253I probably benign Het
Vps8 A T 16: 21,470,123 N411Y probably damaging Het
Zfp932 T A 5: 110,009,954 V506E probably benign Het
Other mutations in 2610507B11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:2610507B11Rik APN 11 78269574 missense possibly damaging 0.55
IGL00497:2610507B11Rik APN 11 78272933 missense probably damaging 1.00
IGL00797:2610507B11Rik APN 11 78273150 missense probably benign 0.07
IGL01695:2610507B11Rik APN 11 78265193 missense probably benign 0.03
IGL02055:2610507B11Rik APN 11 78286631 missense probably damaging 1.00
IGL02066:2610507B11Rik APN 11 78273232 missense probably damaging 1.00
IGL02231:2610507B11Rik APN 11 78279896 missense probably benign
IGL02282:2610507B11Rik APN 11 78284228 missense probably benign 0.22
IGL02293:2610507B11Rik APN 11 78271910 missense probably damaging 1.00
IGL02336:2610507B11Rik APN 11 78289032 missense probably damaging 1.00
IGL02528:2610507B11Rik APN 11 78271976 missense possibly damaging 0.93
IGL03231:2610507B11Rik APN 11 78268702 missense probably benign 0.02
R0003:2610507B11Rik UTSW 11 78286578 missense possibly damaging 0.66
R0197:2610507B11Rik UTSW 11 78269704 unclassified probably benign
R0244:2610507B11Rik UTSW 11 78286491 unclassified probably null
R0281:2610507B11Rik UTSW 11 78271924 missense possibly damaging 0.88
R0396:2610507B11Rik UTSW 11 78268377 missense possibly damaging 0.93
R0624:2610507B11Rik UTSW 11 78268457 missense probably damaging 1.00
R0666:2610507B11Rik UTSW 11 78287987 missense probably damaging 1.00
R0666:2610507B11Rik UTSW 11 78277212 nonsense probably null
R1313:2610507B11Rik UTSW 11 78265672 missense probably benign 0.02
R1313:2610507B11Rik UTSW 11 78265672 missense probably benign 0.02
R1443:2610507B11Rik UTSW 11 78262798 missense probably damaging 1.00
R1485:2610507B11Rik UTSW 11 78285580 missense probably damaging 1.00
R1500:2610507B11Rik UTSW 11 78284132 missense possibly damaging 0.46
R1537:2610507B11Rik UTSW 11 78289343 missense probably damaging 1.00
R1543:2610507B11Rik UTSW 11 78275174 missense probably benign 0.44
R1702:2610507B11Rik UTSW 11 78289028 missense probably damaging 1.00
R1804:2610507B11Rik UTSW 11 78273469 missense probably damaging 1.00
R1835:2610507B11Rik UTSW 11 78287750 missense probably damaging 0.97
R1852:2610507B11Rik UTSW 11 78268473 missense probably damaging 1.00
R1861:2610507B11Rik UTSW 11 78287929 unclassified probably benign
R1986:2610507B11Rik UTSW 11 78274612 missense probably damaging 1.00
R1987:2610507B11Rik UTSW 11 78268167 missense probably damaging 1.00
R2061:2610507B11Rik UTSW 11 78268749 nonsense probably null
R2113:2610507B11Rik UTSW 11 78268772 missense probably benign 0.02
R3692:2610507B11Rik UTSW 11 78269509 missense probably damaging 1.00
R3788:2610507B11Rik UTSW 11 78288297 critical splice donor site probably null
R3835:2610507B11Rik UTSW 11 78279085 missense probably benign 0.17
R3882:2610507B11Rik UTSW 11 78262700 missense probably damaging 1.00
R3943:2610507B11Rik UTSW 11 78269524 nonsense probably null
R3945:2610507B11Rik UTSW 11 78289964 missense probably damaging 1.00
R4196:2610507B11Rik UTSW 11 78263556 intron probably benign
R4510:2610507B11Rik UTSW 11 78277328 missense possibly damaging 0.59
R4511:2610507B11Rik UTSW 11 78277328 missense possibly damaging 0.59
R4756:2610507B11Rik UTSW 11 78264028 missense probably damaging 0.98
R5337:2610507B11Rik UTSW 11 78265208 missense possibly damaging 0.46
R5419:2610507B11Rik UTSW 11 78272090 nonsense probably null
R5572:2610507B11Rik UTSW 11 78264567 missense probably damaging 0.98
R5719:2610507B11Rik UTSW 11 78273245 missense probably damaging 0.97
R5754:2610507B11Rik UTSW 11 78269541 missense probably damaging 1.00
R5890:2610507B11Rik UTSW 11 78273270 nonsense probably null
R5919:2610507B11Rik UTSW 11 78289350 missense probably damaging 1.00
R5925:2610507B11Rik UTSW 11 78284238 missense probably benign 0.06
R5976:2610507B11Rik UTSW 11 78284129 missense probably benign 0.00
R5999:2610507B11Rik UTSW 11 78285468 missense probably damaging 1.00
R6056:2610507B11Rik UTSW 11 78271384 missense possibly damaging 0.77
R6180:2610507B11Rik UTSW 11 78273258 missense possibly damaging 0.51
R6484:2610507B11Rik UTSW 11 78279095 missense probably damaging 1.00
R6721:2610507B11Rik UTSW 11 78279799 missense probably damaging 1.00
R6800:2610507B11Rik UTSW 11 78288279 missense probably benign 0.13
R6911:2610507B11Rik UTSW 11 78268353 missense probably damaging 0.99
R6923:2610507B11Rik UTSW 11 78274626 missense possibly damaging 0.67
X0028:2610507B11Rik UTSW 11 78286635 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTTGCCAGGTCTAGTTAGGTAAG -3'
(R):5'- GTGATCCAATCTGGCCCATAG -3'

Sequencing Primer
(F):5'- TGCCAGGTCTAGTTAGGTAAGAGAAG -3'
(R):5'- CTAAAGCATTACCTCTAGAGAGCGG -3'
Posted On2015-04-17