Incidental Mutation 'R3944:March6'
ID307618
Institutional Source Beutler Lab
Gene Symbol March6
Ensembl Gene ENSMUSG00000039100
Gene Namemembrane-associated ring finger (C3HC4) 6
SynonymsF830029L24Rik
MMRRC Submission 040925-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.643) question?
Stock #R3944 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location31455891-31531053 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31488814 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 317 (V317A)
Ref Sequence ENSEMBL: ENSMUSP00000087694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090227]
Predicted Effect probably benign
Transcript: ENSMUST00000090227
AA Change: V317A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000087694
Gene: ENSMUSG00000039100
AA Change: V317A

DomainStartEndE-ValueType
RINGv 8 56 1.13e-21 SMART
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
low complexity region 223 259 N/A INTRINSIC
transmembrane domain 290 312 N/A INTRINSIC
transmembrane domain 332 354 N/A INTRINSIC
transmembrane domain 367 389 N/A INTRINSIC
transmembrane domain 420 442 N/A INTRINSIC
transmembrane domain 480 502 N/A INTRINSIC
transmembrane domain 522 540 N/A INTRINSIC
low complexity region 574 599 N/A INTRINSIC
transmembrane domain 633 655 N/A INTRINSIC
transmembrane domain 675 697 N/A INTRINSIC
transmembrane domain 720 742 N/A INTRINSIC
transmembrane domain 762 784 N/A INTRINSIC
transmembrane domain 805 827 N/A INTRINSIC
transmembrane domain 847 866 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227757
Meta Mutation Damage Score 0.1848 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of membrane-associated E3 ubiquitin ligases containing RING-CH-type zinc finger motifs. Ubiquitination of type II deiodinase by the encoded protein is an important regulatory step in thyroid hormone signalling. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,269,524 L603* probably null Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4932438A13Rik A G 3: 37,030,061 I3876V possibly damaging Het
6430548M08Rik T C 8: 120,152,502 L213P probably damaging Het
Akap12 A G 10: 4,357,347 K1491E probably benign Het
Akr1c12 T A 13: 4,279,340 H6L probably benign Het
Ankrd50 C T 3: 38,452,496 C251Y probably benign Het
Calu T C 6: 29,361,711 S125P possibly damaging Het
Cdh10 A G 15: 18,964,249 T166A probably benign Het
Clip1 T C 5: 123,617,829 probably benign Het
Cntn4 T G 6: 106,618,414 N497K probably benign Het
Cspg4 T A 9: 56,886,123 C381S probably damaging Het
Cyp1a2 T C 9: 57,681,868 N221S probably benign Het
Dnaaf5 C T 5: 139,152,924 probably benign Het
Dnah7b A G 1: 46,137,485 D755G probably damaging Het
Dscam A T 16: 96,820,997 V418E probably damaging Het
Eefsec T A 6: 88,298,094 H296L probably benign Het
Elmo3 T C 8: 105,309,220 probably null Het
Gcm1 C T 9: 78,059,816 Q106* probably null Het
Gnl1 G T 17: 35,988,521 G528V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
H2-T23 A G 17: 36,030,643 V312A probably benign Het
Hectd4 C A 5: 121,303,525 probably benign Het
Hoxa7 T A 6: 52,216,626 probably benign Het
Ifnlr1 T A 4: 135,701,228 V122E probably damaging Het
Kcnt2 T C 1: 140,584,287 M1036T probably damaging Het
Khdc1b G T 1: 21,384,806 K96N probably damaging Het
Kif19a A T 11: 114,786,735 Y578F probably benign Het
Krt4 G A 15: 101,921,250 T281M probably benign Het
Lyl1 A C 8: 84,704,002 T178P probably damaging Het
Mmp1b G A 9: 7,384,708 T280I possibly damaging Het
Mpi T C 9: 57,545,253 D332G probably damaging Het
Naip6 T C 13: 100,294,739 T1197A probably benign Het
Ntng2 G A 2: 29,204,277 L361F probably benign Het
Obscn A T 11: 59,132,547 I668N probably damaging Het
Olfr1090 A G 2: 86,754,181 S186P probably benign Het
Olfr686 A T 7: 105,203,955 C129* probably null Het
Pabpc1l A G 2: 164,042,327 E328G probably damaging Het
Pan3 A T 5: 147,450,730 N170Y probably damaging Het
Prdm2 C T 4: 143,131,815 R1635Q possibly damaging Het
Rassf6 G T 5: 90,604,326 Q258K possibly damaging Het
Ribc2 A G 15: 85,135,250 M78V probably benign Het
Rp9 A C 9: 22,449,858 H44Q probably damaging Het
Skint5 T A 4: 113,942,753 H73L probably damaging Het
Slc6a12 A T 6: 121,354,280 probably null Het
Smg6 G A 11: 74,929,541 G213R probably damaging Het
Spout1 A G 2: 30,174,136 V372A probably benign Het
Svep1 T A 4: 58,084,807 probably null Het
Tab1 T C 15: 80,153,740 L258P probably damaging Het
Tbl3 A G 17: 24,700,708 S791P possibly damaging Het
Tcof1 C A 18: 60,822,837 D927Y probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Topaz1 T C 9: 122,750,604 S860P possibly damaging Het
Vill T C 9: 119,068,431 I258T probably benign Het
Vmn1r204 G A 13: 22,556,844 R215H probably benign Het
Vmn2r106 A T 17: 20,267,651 F829I probably damaging Het
Vmn2r14 A T 5: 109,216,064 I662N probably damaging Het
Vmn2r58 A T 7: 41,864,461 F253I probably benign Het
Vps8 A T 16: 21,470,123 N411Y probably damaging Het
Zfp932 T A 5: 110,009,954 V506E probably benign Het
Other mutations in March6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:March6 APN 15 31475763 missense probably benign 0.00
IGL00902:March6 APN 15 31484978 missense probably damaging 1.00
IGL02352:March6 APN 15 31509759 missense probably damaging 1.00
IGL02359:March6 APN 15 31509759 missense probably damaging 1.00
IGL02565:March6 APN 15 31490566 splice site probably benign
IGL02735:March6 APN 15 31486120 missense probably benign 0.00
IGL02808:March6 APN 15 31478406 missense probably benign 0.32
IGL03122:March6 APN 15 31478293 critical splice donor site probably null
IGL03235:March6 APN 15 31485995 missense probably damaging 1.00
IGL03238:March6 APN 15 31461941 critical splice donor site probably benign
IGL03263:March6 APN 15 31486362 missense probably benign 0.01
R0003:March6 UTSW 15 31469532 splice site probably benign
R0056:March6 UTSW 15 31467734 missense possibly damaging 0.68
R0115:March6 UTSW 15 31475812 missense probably benign
R0126:March6 UTSW 15 31462005 missense probably benign 0.00
R0148:March6 UTSW 15 31490612 missense probably damaging 0.99
R0744:March6 UTSW 15 31480291 missense probably benign 0.00
R0833:March6 UTSW 15 31480291 missense probably benign 0.00
R1205:March6 UTSW 15 31469673 missense probably benign 0.01
R1339:March6 UTSW 15 31486402 missense probably benign 0.12
R1485:March6 UTSW 15 31498693 missense probably damaging 0.96
R1885:March6 UTSW 15 31502806 missense probably benign 0.00
R1889:March6 UTSW 15 31459193 missense possibly damaging 0.86
R1984:March6 UTSW 15 31469646 missense probably damaging 0.99
R2007:March6 UTSW 15 31461941 critical splice donor site probably null
R2046:March6 UTSW 15 31486434 missense probably benign 0.01
R2135:March6 UTSW 15 31509764 nonsense probably null
R3116:March6 UTSW 15 31486119 missense probably benign 0.00
R3710:March6 UTSW 15 31509826 splice site probably benign
R3715:March6 UTSW 15 31465259 missense probably benign 0.00
R3749:March6 UTSW 15 31462014 missense probably benign 0.00
R4327:March6 UTSW 15 31498741 missense probably benign 0.17
R4329:March6 UTSW 15 31498741 missense probably benign 0.17
R5001:March6 UTSW 15 31465322 missense probably damaging 0.98
R5149:March6 UTSW 15 31461994 missense possibly damaging 0.53
R5654:March6 UTSW 15 31485936 missense probably damaging 1.00
R6163:March6 UTSW 15 31465351 missense probably benign
R6172:March6 UTSW 15 31482867 missense possibly damaging 0.86
R6381:March6 UTSW 15 31467692 missense probably benign 0.01
R6888:March6 UTSW 15 31459233 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCCTTTGCACAAGATACACTGAG -3'
(R):5'- CAGGCAGTTATTCTCTGGTTGT -3'

Sequencing Primer
(F):5'- TGCTCTTCCAAAGGTCCAGAG -3'
(R):5'- GGAACTCACTCTATAGATCAGGCTG -3'
Posted On2015-04-17