Incidental Mutation 'R3944:Tab1'
ID307619
Institutional Source Beutler Lab
Gene Symbol Tab1
Ensembl Gene ENSMUSG00000022414
Gene NameTGF-beta activated kinase 1/MAP3K7 binding protein 1
Synonyms2310012M03Rik, Map3k7ip1, b2b449Clo, Tak1-binding protein 1
MMRRC Submission 040925-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3944 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location80133127-80161707 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80153740 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 258 (L258P)
Ref Sequence ENSEMBL: ENSMUSP00000023050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023050] [ENSMUST00000229320]
PDB Structure
Structural basis of autoactivation of p38 alpha induced by TAB1 (Monoclinic crystal form) [X-RAY DIFFRACTION]
Structural basis of autoactivation of p38 alpha induced by TAB1 (Tetragonal crystal form) [X-RAY DIFFRACTION]
Structural basis of autoactivation of p38 alpha induced by TAB1 (Tetragonal crystal form with bound sulphate) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000023050
AA Change: L258P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023050
Gene: ENSMUSG00000022414
AA Change: L258P

DomainStartEndE-ValueType
PP2Cc 26 363 7.45e-40 SMART
low complexity region 397 408 N/A INTRINSIC
low complexity region 438 455 N/A INTRINSIC
PDB:4L3P|A 466 502 6e-17 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000229320
Meta Mutation Damage Score 0.338 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified as a regulator of the MAP kinase kinase kinase MAP3K7/TAK1, which is known to mediate various intracellular signaling pathways, such as those induced by TGF beta, interleukin 1, and WNT-1. This protein interacts and thus activates TAK1 kinase. It has been shown that the C-terminal portion of this protein is sufficient for binding and activation of TAK1, while a portion of the N-terminus acts as a dominant-negative inhibitor of TGF beta, suggesting that this protein may function as a mediator between TGF beta receptors and TAK1. This protein can also interact with and activate the mitogen-activated protein kinase 14 (MAPK14/p38alpha), and thus represents an alternative activation pathway, in addition to the MAPKK pathways, which contributes to the biological responses of MAPK14 to various stimuli. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant fetuses exhibit edema, hemorrhaging, cardiovascular and pulmonary dysmorphogenesis, and die in the late stages of gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,269,524 L603* probably null Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4932438A13Rik A G 3: 37,030,061 I3876V possibly damaging Het
6430548M08Rik T C 8: 120,152,502 L213P probably damaging Het
Akap12 A G 10: 4,357,347 K1491E probably benign Het
Akr1c12 T A 13: 4,279,340 H6L probably benign Het
Ankrd50 C T 3: 38,452,496 C251Y probably benign Het
Calu T C 6: 29,361,711 S125P possibly damaging Het
Cdh10 A G 15: 18,964,249 T166A probably benign Het
Clip1 T C 5: 123,617,829 probably benign Het
Cntn4 T G 6: 106,618,414 N497K probably benign Het
Cspg4 T A 9: 56,886,123 C381S probably damaging Het
Cyp1a2 T C 9: 57,681,868 N221S probably benign Het
Dnaaf5 C T 5: 139,152,924 probably benign Het
Dnah7b A G 1: 46,137,485 D755G probably damaging Het
Dscam A T 16: 96,820,997 V418E probably damaging Het
Eefsec T A 6: 88,298,094 H296L probably benign Het
Elmo3 T C 8: 105,309,220 probably null Het
Gcm1 C T 9: 78,059,816 Q106* probably null Het
Gnl1 G T 17: 35,988,521 G528V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
H2-T23 A G 17: 36,030,643 V312A probably benign Het
Hectd4 C A 5: 121,303,525 probably benign Het
Hoxa7 T A 6: 52,216,626 probably benign Het
Ifnlr1 T A 4: 135,701,228 V122E probably damaging Het
Kcnt2 T C 1: 140,584,287 M1036T probably damaging Het
Khdc1b G T 1: 21,384,806 K96N probably damaging Het
Kif19a A T 11: 114,786,735 Y578F probably benign Het
Krt4 G A 15: 101,921,250 T281M probably benign Het
Lyl1 A C 8: 84,704,002 T178P probably damaging Het
March6 A G 15: 31,488,814 V317A probably benign Het
Mmp1b G A 9: 7,384,708 T280I possibly damaging Het
Mpi T C 9: 57,545,253 D332G probably damaging Het
Naip6 T C 13: 100,294,739 T1197A probably benign Het
Ntng2 G A 2: 29,204,277 L361F probably benign Het
Obscn A T 11: 59,132,547 I668N probably damaging Het
Olfr1090 A G 2: 86,754,181 S186P probably benign Het
Olfr686 A T 7: 105,203,955 C129* probably null Het
Pabpc1l A G 2: 164,042,327 E328G probably damaging Het
Pan3 A T 5: 147,450,730 N170Y probably damaging Het
Prdm2 C T 4: 143,131,815 R1635Q possibly damaging Het
Rassf6 G T 5: 90,604,326 Q258K possibly damaging Het
Ribc2 A G 15: 85,135,250 M78V probably benign Het
Rp9 A C 9: 22,449,858 H44Q probably damaging Het
Skint5 T A 4: 113,942,753 H73L probably damaging Het
Slc6a12 A T 6: 121,354,280 probably null Het
Smg6 G A 11: 74,929,541 G213R probably damaging Het
Spout1 A G 2: 30,174,136 V372A probably benign Het
Svep1 T A 4: 58,084,807 probably null Het
Tbl3 A G 17: 24,700,708 S791P possibly damaging Het
Tcof1 C A 18: 60,822,837 D927Y probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Topaz1 T C 9: 122,750,604 S860P possibly damaging Het
Vill T C 9: 119,068,431 I258T probably benign Het
Vmn1r204 G A 13: 22,556,844 R215H probably benign Het
Vmn2r106 A T 17: 20,267,651 F829I probably damaging Het
Vmn2r14 A T 5: 109,216,064 I662N probably damaging Het
Vmn2r58 A T 7: 41,864,461 F253I probably benign Het
Vps8 A T 16: 21,470,123 N411Y probably damaging Het
Zfp932 T A 5: 110,009,954 V506E probably benign Het
Other mutations in Tab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02686:Tab1 APN 15 80148830 missense probably benign 0.05
memento UTSW 15 80153668 missense probably damaging 0.96
Memoir UTSW 15 80153740 missense probably damaging 1.00
R0085:Tab1 UTSW 15 80155893 missense probably benign 0.00
R1341:Tab1 UTSW 15 80160114 missense possibly damaging 0.86
R1835:Tab1 UTSW 15 80148296 missense probably benign 0.42
R1907:Tab1 UTSW 15 80153668 missense probably damaging 0.96
R3113:Tab1 UTSW 15 80148260 missense probably benign 0.23
R3943:Tab1 UTSW 15 80153740 missense probably damaging 1.00
R4845:Tab1 UTSW 15 80152763 missense probably damaging 1.00
R5345:Tab1 UTSW 15 80149813 missense possibly damaging 0.48
R5696:Tab1 UTSW 15 80148729 nonsense probably null
R6223:Tab1 UTSW 15 80148263 missense probably damaging 1.00
R6242:Tab1 UTSW 15 80155770 nonsense probably null
R6561:Tab1 UTSW 15 80148830 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGTAGGCGGAGACCTGTTAG -3'
(R):5'- AGCTCACAGGATCAGACTGC -3'

Sequencing Primer
(F):5'- TGTGACTCTCCATCATGACAGGG -3'
(R):5'- TCAGACTGCTGACCTAGGC -3'
Posted On2015-04-17