Incidental Mutation 'R3944:Krt4'
ID307621
Institutional Source Beutler Lab
Gene Symbol Krt4
Ensembl Gene ENSMUSG00000059668
Gene Namekeratin 4
SynonymsKrt-2.4, K4, Krt2-4
MMRRC Submission 040925-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R3944 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location101918535-101924735 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101921250 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 281 (T281M)
Ref Sequence ENSEMBL: ENSMUSP00000023797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023797]
Predicted Effect probably benign
Transcript: ENSMUST00000023797
AA Change: T281M

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000023797
Gene: ENSMUSG00000059668
AA Change: T281M

DomainStartEndE-ValueType
Pfam:Keratin_2_head 14 142 4.7e-37 PFAM
Filament 145 458 1.61e-166 SMART
low complexity region 465 511 N/A INTRINSIC
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in differentiated layers of the mucosal and esophageal epithelia with family member KRT13. Mutations in these genes have been associated with White Sponge Nevus, characterized by oral, esophageal, and anal leukoplakia. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display hyperplasia throughout the epithelium of the esophagus and tongue. Mice homozygous or heterozygous for a dominant mutation display oral leukoplakia and homozygotes display postnatal growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,269,524 L603* probably null Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4932438A13Rik A G 3: 37,030,061 I3876V possibly damaging Het
6430548M08Rik T C 8: 120,152,502 L213P probably damaging Het
Akap12 A G 10: 4,357,347 K1491E probably benign Het
Akr1c12 T A 13: 4,279,340 H6L probably benign Het
Ankrd50 C T 3: 38,452,496 C251Y probably benign Het
Calu T C 6: 29,361,711 S125P possibly damaging Het
Cdh10 A G 15: 18,964,249 T166A probably benign Het
Clip1 T C 5: 123,617,829 probably benign Het
Cntn4 T G 6: 106,618,414 N497K probably benign Het
Cspg4 T A 9: 56,886,123 C381S probably damaging Het
Cyp1a2 T C 9: 57,681,868 N221S probably benign Het
Dnaaf5 C T 5: 139,152,924 probably benign Het
Dnah7b A G 1: 46,137,485 D755G probably damaging Het
Dscam A T 16: 96,820,997 V418E probably damaging Het
Eefsec T A 6: 88,298,094 H296L probably benign Het
Elmo3 T C 8: 105,309,220 probably null Het
Gcm1 C T 9: 78,059,816 Q106* probably null Het
Gnl1 G T 17: 35,988,521 G528V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
H2-T23 A G 17: 36,030,643 V312A probably benign Het
Hectd4 C A 5: 121,303,525 probably benign Het
Hoxa7 T A 6: 52,216,626 probably benign Het
Ifnlr1 T A 4: 135,701,228 V122E probably damaging Het
Kcnt2 T C 1: 140,584,287 M1036T probably damaging Het
Khdc1b G T 1: 21,384,806 K96N probably damaging Het
Kif19a A T 11: 114,786,735 Y578F probably benign Het
Lyl1 A C 8: 84,704,002 T178P probably damaging Het
March6 A G 15: 31,488,814 V317A probably benign Het
Mmp1b G A 9: 7,384,708 T280I possibly damaging Het
Mpi T C 9: 57,545,253 D332G probably damaging Het
Naip6 T C 13: 100,294,739 T1197A probably benign Het
Ntng2 G A 2: 29,204,277 L361F probably benign Het
Obscn A T 11: 59,132,547 I668N probably damaging Het
Olfr1090 A G 2: 86,754,181 S186P probably benign Het
Olfr686 A T 7: 105,203,955 C129* probably null Het
Pabpc1l A G 2: 164,042,327 E328G probably damaging Het
Pan3 A T 5: 147,450,730 N170Y probably damaging Het
Prdm2 C T 4: 143,131,815 R1635Q possibly damaging Het
Rassf6 G T 5: 90,604,326 Q258K possibly damaging Het
Ribc2 A G 15: 85,135,250 M78V probably benign Het
Rp9 A C 9: 22,449,858 H44Q probably damaging Het
Skint5 T A 4: 113,942,753 H73L probably damaging Het
Slc6a12 A T 6: 121,354,280 probably null Het
Smg6 G A 11: 74,929,541 G213R probably damaging Het
Spout1 A G 2: 30,174,136 V372A probably benign Het
Svep1 T A 4: 58,084,807 probably null Het
Tab1 T C 15: 80,153,740 L258P probably damaging Het
Tbl3 A G 17: 24,700,708 S791P possibly damaging Het
Tcof1 C A 18: 60,822,837 D927Y probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Topaz1 T C 9: 122,750,604 S860P possibly damaging Het
Vill T C 9: 119,068,431 I258T probably benign Het
Vmn1r204 G A 13: 22,556,844 R215H probably benign Het
Vmn2r106 A T 17: 20,267,651 F829I probably damaging Het
Vmn2r14 A T 5: 109,216,064 I662N probably damaging Het
Vmn2r58 A T 7: 41,864,461 F253I probably benign Het
Vps8 A T 16: 21,470,123 N411Y probably damaging Het
Zfp932 T A 5: 110,009,954 V506E probably benign Het
Other mutations in Krt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Krt4 APN 15 101920281 missense probably damaging 1.00
IGL02306:Krt4 APN 15 101921305 missense probably benign 0.13
IGL02407:Krt4 APN 15 101921305 missense probably benign 0.13
IGL02504:Krt4 APN 15 101919292 missense unknown
R0042:Krt4 UTSW 15 101922752 splice site probably benign
R0042:Krt4 UTSW 15 101922752 splice site probably benign
R0211:Krt4 UTSW 15 101922782 missense possibly damaging 0.80
R0363:Krt4 UTSW 15 101924646 missense possibly damaging 0.91
R2018:Krt4 UTSW 15 101920651 missense probably damaging 1.00
R2067:Krt4 UTSW 15 101924664 missense possibly damaging 0.70
R2571:Krt4 UTSW 15 101921257 missense probably damaging 1.00
R3943:Krt4 UTSW 15 101921250 missense probably benign 0.00
R5104:Krt4 UTSW 15 101920323 missense probably damaging 1.00
R5107:Krt4 UTSW 15 101922791 missense possibly damaging 0.89
R5579:Krt4 UTSW 15 101921234 missense probably benign 0.01
R6052:Krt4 UTSW 15 101922759 critical splice donor site probably null
R6429:Krt4 UTSW 15 101922794 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGAAACTCTCCACTGACTCTCTC -3'
(R):5'- CATAGCGATCTTGCACAGCC -3'

Sequencing Primer
(F):5'- ACTGACTCTCTCACTATACTCCAG -3'
(R):5'- CACAGCCTTTTAGAATGTGTAAGGG -3'
Posted On2015-04-17