Incidental Mutation 'R3944:Vps8'
ID307622
Institutional Source Beutler Lab
Gene Symbol Vps8
Ensembl Gene ENSMUSG00000033653
Gene NameVPS8 CORVET complex subunit
Synonyms
MMRRC Submission 040925-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3944 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location21423118-21644680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21470123 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 411 (N411Y)
Ref Sequence ENSEMBL: ENSMUSP00000112636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096191] [ENSMUST00000096192] [ENSMUST00000115397] [ENSMUST00000117598] [ENSMUST00000118923]
Predicted Effect probably damaging
Transcript: ENSMUST00000096191
AA Change: N409Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093905
Gene: ENSMUSG00000033653
AA Change: N409Y

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 296 1e-8 SMART
Blast:WD40 184 225 7e-22 BLAST
Blast:WD40 228 268 5e-20 BLAST
Pfam:Vps8 610 794 1.7e-61 PFAM
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1085 1097 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
Blast:RING 1257 1277 1e-5 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000096192
AA Change: N411Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093906
Gene: ENSMUSG00000033653
AA Change: N411Y

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 298 1e-8 SMART
Blast:WD40 186 227 8e-22 BLAST
Blast:WD40 230 270 5e-20 BLAST
Pfam:Vps8 612 796 1.4e-61 PFAM
low complexity region 969 979 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1098 1109 N/A INTRINSIC
RING 1229 1280 1.23e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115397
AA Change: N411Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111055
Gene: ENSMUSG00000033653
AA Change: N411Y

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 298 8e-9 SMART
Blast:WD40 186 227 8e-22 BLAST
Blast:WD40 230 270 5e-20 BLAST
Pfam:Vps8 613 796 1.3e-61 PFAM
low complexity region 994 1009 N/A INTRINSIC
low complexity region 1087 1099 N/A INTRINSIC
low complexity region 1128 1139 N/A INTRINSIC
RING 1259 1310 1.23e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117598
AA Change: N409Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112937
Gene: ENSMUSG00000033653
AA Change: N409Y

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 296 1e-8 SMART
Blast:WD40 184 225 8e-22 BLAST
Blast:WD40 228 268 5e-20 BLAST
Pfam:Vps8 610 794 1.9e-61 PFAM
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1085 1097 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
RING 1257 1308 1.23e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118923
AA Change: N411Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112636
Gene: ENSMUSG00000033653
AA Change: N411Y

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 298 9e-9 SMART
Blast:WD40 186 227 8e-22 BLAST
Blast:WD40 230 270 5e-20 BLAST
Pfam:Vps8 612 796 1.9e-61 PFAM
low complexity region 969 979 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1098 1109 N/A INTRINSIC
RING 1229 1280 1.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125487
SMART Domains Protein: ENSMUSP00000114719
Gene: ENSMUSG00000033653

DomainStartEndE-ValueType
Pfam:Vps8 182 365 8.5e-62 PFAM
low complexity region 563 578 N/A INTRINSIC
low complexity region 656 668 N/A INTRINSIC
low complexity region 697 708 N/A INTRINSIC
RING 828 879 1.23e-4 SMART
Meta Mutation Damage Score 0.348 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,269,524 L603* probably null Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4932438A13Rik A G 3: 37,030,061 I3876V possibly damaging Het
6430548M08Rik T C 8: 120,152,502 L213P probably damaging Het
Akap12 A G 10: 4,357,347 K1491E probably benign Het
Akr1c12 T A 13: 4,279,340 H6L probably benign Het
Ankrd50 C T 3: 38,452,496 C251Y probably benign Het
Calu T C 6: 29,361,711 S125P possibly damaging Het
Cdh10 A G 15: 18,964,249 T166A probably benign Het
Clip1 T C 5: 123,617,829 probably benign Het
Cntn4 T G 6: 106,618,414 N497K probably benign Het
Cspg4 T A 9: 56,886,123 C381S probably damaging Het
Cyp1a2 T C 9: 57,681,868 N221S probably benign Het
Dnaaf5 C T 5: 139,152,924 probably benign Het
Dnah7b A G 1: 46,137,485 D755G probably damaging Het
Dscam A T 16: 96,820,997 V418E probably damaging Het
Eefsec T A 6: 88,298,094 H296L probably benign Het
Elmo3 T C 8: 105,309,220 probably null Het
Gcm1 C T 9: 78,059,816 Q106* probably null Het
Gnl1 G T 17: 35,988,521 G528V probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
H2-T23 A G 17: 36,030,643 V312A probably benign Het
Hectd4 C A 5: 121,303,525 probably benign Het
Hoxa7 T A 6: 52,216,626 probably benign Het
Ifnlr1 T A 4: 135,701,228 V122E probably damaging Het
Kcnt2 T C 1: 140,584,287 M1036T probably damaging Het
Khdc1b G T 1: 21,384,806 K96N probably damaging Het
Kif19a A T 11: 114,786,735 Y578F probably benign Het
Krt4 G A 15: 101,921,250 T281M probably benign Het
Lyl1 A C 8: 84,704,002 T178P probably damaging Het
March6 A G 15: 31,488,814 V317A probably benign Het
Mmp1b G A 9: 7,384,708 T280I possibly damaging Het
Mpi T C 9: 57,545,253 D332G probably damaging Het
Naip6 T C 13: 100,294,739 T1197A probably benign Het
Ntng2 G A 2: 29,204,277 L361F probably benign Het
Obscn A T 11: 59,132,547 I668N probably damaging Het
Olfr1090 A G 2: 86,754,181 S186P probably benign Het
Olfr686 A T 7: 105,203,955 C129* probably null Het
Pabpc1l A G 2: 164,042,327 E328G probably damaging Het
Pan3 A T 5: 147,450,730 N170Y probably damaging Het
Prdm2 C T 4: 143,131,815 R1635Q possibly damaging Het
Rassf6 G T 5: 90,604,326 Q258K possibly damaging Het
Ribc2 A G 15: 85,135,250 M78V probably benign Het
Rp9 A C 9: 22,449,858 H44Q probably damaging Het
Skint5 T A 4: 113,942,753 H73L probably damaging Het
Slc6a12 A T 6: 121,354,280 probably null Het
Smg6 G A 11: 74,929,541 G213R probably damaging Het
Spout1 A G 2: 30,174,136 V372A probably benign Het
Svep1 T A 4: 58,084,807 probably null Het
Tab1 T C 15: 80,153,740 L258P probably damaging Het
Tbl3 A G 17: 24,700,708 S791P possibly damaging Het
Tcof1 C A 18: 60,822,837 D927Y probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Topaz1 T C 9: 122,750,604 S860P possibly damaging Het
Vill T C 9: 119,068,431 I258T probably benign Het
Vmn1r204 G A 13: 22,556,844 R215H probably benign Het
Vmn2r106 A T 17: 20,267,651 F829I probably damaging Het
Vmn2r14 A T 5: 109,216,064 I662N probably damaging Het
Vmn2r58 A T 7: 41,864,461 F253I probably benign Het
Zfp932 T A 5: 110,009,954 V506E probably benign Het
Other mutations in Vps8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Vps8 APN 16 21442334 missense possibly damaging 0.47
IGL00596:Vps8 APN 16 21448412 splice site probably benign
IGL00985:Vps8 APN 16 21477584 splice site probably benign
IGL01356:Vps8 APN 16 21517357 critical splice donor site probably null
IGL01375:Vps8 APN 16 21559372 nonsense probably null
IGL01643:Vps8 APN 16 21518222 missense possibly damaging 0.92
IGL02159:Vps8 APN 16 21466484 missense possibly damaging 0.69
IGL02214:Vps8 APN 16 21517285 missense probably damaging 1.00
IGL02465:Vps8 APN 16 21521903 missense probably damaging 1.00
IGL02651:Vps8 APN 16 21517336 missense probably damaging 0.99
IGL03174:Vps8 APN 16 21466463 missense probably damaging 1.00
IGL03337:Vps8 APN 16 21563168 missense probably benign
IGL03383:Vps8 APN 16 21435823 critical splice donor site probably null
IGL03402:Vps8 APN 16 21448398 missense possibly damaging 0.68
empires UTSW 16 21581548 nonsense probably null
porky UTSW 16 21461238 missense probably benign 0.32
realm UTSW 16 21545236 intron probably benign
realms UTSW 16 21444188 unclassified probably null
Reich UTSW 16 21478439 missense probably benign 0.29
reichen UTSW 16 21506825 splice site probably benign
IGL03052:Vps8 UTSW 16 21448365 missense probably damaging 0.99
PIT4677001:Vps8 UTSW 16 21500334 missense possibly damaging 0.94
R0066:Vps8 UTSW 16 21477523 missense possibly damaging 0.77
R0066:Vps8 UTSW 16 21477523 missense possibly damaging 0.77
R0125:Vps8 UTSW 16 21470154 missense probably benign 0.00
R0137:Vps8 UTSW 16 21504386 splice site probably benign
R0362:Vps8 UTSW 16 21608227 intron probably benign
R0384:Vps8 UTSW 16 21506825 splice site probably benign
R0492:Vps8 UTSW 16 21442357 missense probably damaging 1.00
R0525:Vps8 UTSW 16 21540109 critical splice donor site probably null
R0531:Vps8 UTSW 16 21459811 intron probably benign
R0605:Vps8 UTSW 16 21559337 missense probably benign 0.00
R0636:Vps8 UTSW 16 21434933 missense probably benign 0.32
R0707:Vps8 UTSW 16 21442357 missense probably damaging 1.00
R0840:Vps8 UTSW 16 21456321 missense probably damaging 0.99
R1170:Vps8 UTSW 16 21459820 intron probably benign
R1203:Vps8 UTSW 16 21511557 missense probably damaging 1.00
R1482:Vps8 UTSW 16 21581598 missense probably benign 0.00
R1531:Vps8 UTSW 16 21466476 nonsense probably null
R1642:Vps8 UTSW 16 21581579 missense probably benign
R1956:Vps8 UTSW 16 21461142 missense probably damaging 1.00
R2201:Vps8 UTSW 16 21576757 missense probably damaging 1.00
R2287:Vps8 UTSW 16 21568413 missense probably damaging 1.00
R2423:Vps8 UTSW 16 21559337 missense probably benign 0.00
R3151:Vps8 UTSW 16 21442373 missense probably benign 0.04
R3943:Vps8 UTSW 16 21470123 missense probably damaging 1.00
R4043:Vps8 UTSW 16 21526396 missense probably damaging 1.00
R4302:Vps8 UTSW 16 21495914 missense probably damaging 1.00
R4398:Vps8 UTSW 16 21504466 missense probably damaging 1.00
R4477:Vps8 UTSW 16 21545236 intron probably benign
R4478:Vps8 UTSW 16 21545236 intron probably benign
R4479:Vps8 UTSW 16 21545236 intron probably benign
R4480:Vps8 UTSW 16 21545236 intron probably benign
R4571:Vps8 UTSW 16 21435775 missense probably damaging 1.00
R4653:Vps8 UTSW 16 21500210 missense probably damaging 1.00
R4664:Vps8 UTSW 16 21444188 unclassified probably null
R4713:Vps8 UTSW 16 21442439 missense probably damaging 1.00
R4726:Vps8 UTSW 16 21448404 unclassified probably null
R4959:Vps8 UTSW 16 21459786 missense probably damaging 1.00
R4973:Vps8 UTSW 16 21459786 missense probably damaging 1.00
R4975:Vps8 UTSW 16 21466469 missense probably damaging 1.00
R4992:Vps8 UTSW 16 21461408 missense possibly damaging 0.52
R5144:Vps8 UTSW 16 21559353 missense probably damaging 1.00
R5168:Vps8 UTSW 16 21457445 missense probably damaging 0.99
R5168:Vps8 UTSW 16 21533099 missense probably benign 0.05
R5222:Vps8 UTSW 16 21581548 nonsense probably null
R5231:Vps8 UTSW 16 21576725 missense probably damaging 1.00
R5876:Vps8 UTSW 16 21461439 critical splice donor site probably null
R5963:Vps8 UTSW 16 21470121 missense possibly damaging 0.48
R6010:Vps8 UTSW 16 21545205 intron probably benign
R6023:Vps8 UTSW 16 21461238 missense probably benign 0.32
R6173:Vps8 UTSW 16 21495932 splice site probably null
R6185:Vps8 UTSW 16 21470141 missense probably damaging 0.98
R6264:Vps8 UTSW 16 21559349 nonsense probably null
R6409:Vps8 UTSW 16 21478439 missense probably benign 0.29
R6522:Vps8 UTSW 16 21442379 missense probably damaging 0.99
R6528:Vps8 UTSW 16 21554125 nonsense probably null
R6784:Vps8 UTSW 16 21563207 missense probably benign 0.01
R7040:Vps8 UTSW 16 21575022 missense probably damaging 1.00
R7072:Vps8 UTSW 16 21581579 missense probably benign
R7103:Vps8 UTSW 16 21526441 missense probably damaging 1.00
R7149:Vps8 UTSW 16 21459776 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTTATGCAAGCAGAGTGTC -3'
(R):5'- AATGCCACTGTGGGGAGATC -3'

Sequencing Primer
(F):5'- CCTTATGCAAGCAGAGTGTCATCTG -3'
(R):5'- CCACTGTGGGGAGATCAATGC -3'
Posted On2015-04-17