Incidental Mutation 'R0376:Ikzf4'
ID30764
Institutional Source Beutler Lab
Gene Symbol Ikzf4
Ensembl Gene ENSMUSG00000002578
Gene NameIKAROS family zinc finger 4
SynonymsEos, Zfpn1a4, A630026H08Rik
MMRRC Submission 038582-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.548) question?
Stock #R0376 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128630843-128645991 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128632756 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 618 (N618S)
Ref Sequence ENSEMBL: ENSMUSP00000152617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133342] [ENSMUST00000221150] [ENSMUST00000222067] [ENSMUST00000223162]
Predicted Effect
SMART Domains Protein: ENSMUSP00000066991
Gene: ENSMUSG00000002578
AA Change: N618S

DomainStartEndE-ValueType
ZnF_C2H2 159 181 7.67e-2 SMART
ZnF_C2H2 187 209 1.72e-4 SMART
ZnF_C2H2 215 237 1.72e-4 SMART
ZnF_C2H2 248 271 1.18e-2 SMART
low complexity region 423 436 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
ZnF_C2H2 531 553 7.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133342
SMART Domains Protein: ENSMUSP00000114404
Gene: ENSMUSG00000002578

DomainStartEndE-ValueType
ZnF_C2H2 159 181 7.67e-2 SMART
ZnF_C2H2 187 209 1.72e-4 SMART
ZnF_C2H2 215 237 1.72e-4 SMART
ZnF_C2H2 248 271 1.18e-2 SMART
low complexity region 423 436 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
ZnF_C2H2 531 553 7.49e0 SMART
ZnF_C2H2 559 583 3.52e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221150
AA Change: N618S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000222067
Predicted Effect probably benign
Transcript: ENSMUST00000223162
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.0%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the Ikaros (ZNFN1A1; MIM 603023) family of transcription factors, which includes Eos, are expressed in lymphocytes and are implicated in the control of lymphoid development.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik G A 2: 173,528,327 E132K probably benign Het
Adam6a T C 12: 113,544,690 Y228H probably damaging Het
Als2 A G 1: 59,215,565 F211S probably benign Het
Ankrd12 T A 17: 66,053,009 Q11L probably damaging Het
Anxa5 T C 3: 36,460,488 R115G probably damaging Het
Arhgap10 T C 8: 77,450,824 probably benign Het
Atp2a3 T A 11: 72,982,702 D782E probably damaging Het
Bcr G T 10: 75,145,327 L659F probably damaging Het
Cacna1b A G 2: 24,659,003 probably benign Het
Camp C T 9: 109,848,399 C122Y probably damaging Het
Col12a1 A T 9: 79,693,494 S769R probably benign Het
Cyp2j6 T A 4: 96,526,023 K335I probably damaging Het
Cyp3a11 A C 5: 145,862,452 Y308* probably null Het
Flnb G A 14: 7,946,014 probably null Het
Frmd4a G T 2: 4,572,387 M351I probably damaging Het
Gabrg2 C T 11: 41,916,315 S365N possibly damaging Het
Ggn T C 7: 29,173,022 V609A possibly damaging Het
H60c T C 10: 3,260,435 probably benign Het
Hexdc T A 11: 121,218,165 probably benign Het
Igsf9b A G 9: 27,334,582 T1282A probably benign Het
Ints14 A G 9: 64,983,990 K418E probably damaging Het
Iqgap1 T C 7: 80,723,879 E1454G probably benign Het
Kif13b T C 14: 64,757,404 probably benign Het
Krt71 A C 15: 101,738,070 F328C probably damaging Het
Lama2 T C 10: 27,015,546 T2524A possibly damaging Het
Mfn2 C T 4: 147,885,526 V363I probably benign Het
Mkln1 A T 6: 31,478,018 D496V probably benign Het
Olfr450 A T 6: 42,818,292 M274L probably benign Het
Patj T A 4: 98,568,987 I1242N probably damaging Het
Pcnx C T 12: 81,974,579 probably benign Het
Plcb2 T C 2: 118,717,240 E502G probably damaging Het
Plppr4 G T 3: 117,323,091 H314Q probably benign Het
Prkcsh A G 9: 22,010,251 probably benign Het
Prr14 C T 7: 127,476,643 H181Y probably benign Het
Pus3 A T 9: 35,566,422 M317L possibly damaging Het
Pwwp2a T A 11: 43,704,672 D221E probably benign Het
Rbm15 T C 3: 107,330,938 S715G probably benign Het
Rbm28 A G 6: 29,158,928 probably benign Het
Rhobtb2 A T 14: 69,796,735 V347E probably benign Het
Rimbp2 C T 5: 128,803,861 R161Q probably damaging Het
Scgb1b27 C T 7: 34,021,897 T70I possibly damaging Het
Slc40a1 T C 1: 45,912,491 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spaca9 A G 2: 28,693,660 V104A probably benign Het
Spag7 T C 11: 70,669,190 probably benign Het
Sugp1 A G 8: 70,052,638 D85G probably damaging Het
Sun1 A G 5: 139,226,699 probably benign Het
Tcp11l1 C A 2: 104,697,505 probably benign Het
Tead3 A C 17: 28,341,365 D88E probably damaging Het
Tecpr1 A T 5: 144,207,476 V636E possibly damaging Het
Tldc2 T C 2: 157,095,305 W147R probably damaging Het
Tmem161b A G 13: 84,292,383 T125A probably benign Het
Trrap A G 5: 144,816,339 M1825V probably benign Het
Ttbk2 A G 2: 120,777,581 F186L probably damaging Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Zc3h7a T C 16: 11,156,202 M240V probably benign Het
Zc3hc1 G C 6: 30,372,790 S351W probably damaging Het
Zfp366 T C 13: 99,234,251 M493T probably benign Het
Zfp93 C T 7: 24,275,861 P424S probably damaging Het
Other mutations in Ikzf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Ikzf4 APN 10 128634547 missense probably benign 0.00
IGL01649:Ikzf4 APN 10 128635820 missense probably damaging 1.00
IGL02261:Ikzf4 APN 10 128636722 missense possibly damaging 0.50
IGL02315:Ikzf4 APN 10 128634145 missense probably damaging 1.00
R0099:Ikzf4 UTSW 10 128634197 missense probably damaging 0.97
R0200:Ikzf4 UTSW 10 128634676 missense probably damaging 0.96
R0365:Ikzf4 UTSW 10 128634407 missense probably benign
R0456:Ikzf4 UTSW 10 128635808 missense probably damaging 0.98
R0536:Ikzf4 UTSW 10 128641249 missense probably benign 0.09
R1731:Ikzf4 UTSW 10 128634532 missense probably benign 0.03
R2017:Ikzf4 UTSW 10 128634157 missense probably damaging 1.00
R4158:Ikzf4 UTSW 10 128643736 intron probably benign
R4160:Ikzf4 UTSW 10 128643736 intron probably benign
R4623:Ikzf4 UTSW 10 128641119 missense probably damaging 1.00
R4789:Ikzf4 UTSW 10 128632706 missense probably benign 0.00
R5008:Ikzf4 UTSW 10 128641250 missense probably benign 0.03
R5432:Ikzf4 UTSW 10 128634178 missense probably damaging 1.00
R6091:Ikzf4 UTSW 10 128634673 missense probably benign 0.15
R6445:Ikzf4 UTSW 10 128636555 intron probably null
R7204:Ikzf4 UTSW 10 128643890 missense possibly damaging 0.64
R7219:Ikzf4 UTSW 10 128634383 missense possibly damaging 0.64
R7239:Ikzf4 UTSW 10 128641244 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTTCCACCTGCAATGGAGCTATG -3'
(R):5'- ATTCTCAGGGGCTAAGGCTAGACC -3'

Sequencing Primer
(F):5'- CAATGGAGCTATGCCTCCTC -3'
(R):5'- GGATGGGTAGAACTCTCTCCTC -3'
Posted On2013-04-24