Incidental Mutation 'R3945:Rcbtb1'
ID307671
Institutional Source Beutler Lab
Gene Symbol Rcbtb1
Ensembl Gene ENSMUSG00000035469
Gene Nameregulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
Synonyms
MMRRC Submission 040926-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R3945 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location59201209-59237265 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 59224776 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022551] [ENSMUST00000043227] [ENSMUST00000172810] [ENSMUST00000173547] [ENSMUST00000174009]
Predicted Effect probably null
Transcript: ENSMUST00000022551
SMART Domains Protein: ENSMUSP00000022551
Gene: ENSMUSG00000035469

DomainStartEndE-ValueType
Pfam:RCC1 40 89 3.9e-8 PFAM
Pfam:RCC1 93 143 2e-13 PFAM
Pfam:RCC1_2 130 159 5.7e-12 PFAM
Pfam:RCC1 146 196 2.2e-13 PFAM
Pfam:RCC1_2 183 212 3.2e-8 PFAM
Pfam:RCC1 199 248 5.3e-17 PFAM
Pfam:RCC1_2 235 264 2.2e-11 PFAM
Pfam:RCC1 251 300 2.3e-15 PFAM
BTB 370 467 4.14e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000043227
SMART Domains Protein: ENSMUSP00000037030
Gene: ENSMUSG00000035469

DomainStartEndE-ValueType
Pfam:RCC1 40 88 3.2e-7 PFAM
Pfam:RCC1 93 143 2.6e-13 PFAM
Pfam:RCC1_2 130 159 3.7e-12 PFAM
Pfam:RCC1 146 196 3.8e-14 PFAM
Pfam:RCC1_2 183 212 6.5e-8 PFAM
Pfam:RCC1 199 248 1.3e-16 PFAM
Pfam:RCC1_2 235 264 3.5e-10 PFAM
Pfam:RCC1 251 300 1.2e-13 PFAM
BTB 370 467 4.14e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000095778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147280
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153225
Predicted Effect probably benign
Transcript: ENSMUST00000172810
Predicted Effect probably benign
Transcript: ENSMUST00000173547
SMART Domains Protein: ENSMUSP00000134360
Gene: ENSMUSG00000035469

DomainStartEndE-ValueType
Pfam:RCC1 40 89 9.6e-9 PFAM
Pfam:RCC1 93 143 4.7e-14 PFAM
Pfam:RCC1_2 130 159 1.7e-12 PFAM
Pfam:RCC1 146 196 5.3e-14 PFAM
Pfam:RCC1_2 183 208 7.9e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174009
Predicted Effect probably benign
Transcript: ENSMUST00000174830
SMART Domains Protein: ENSMUSP00000133421
Gene: ENSMUSG00000035469

DomainStartEndE-ValueType
Pfam:RCC1 1 48 2e-12 PFAM
Pfam:RCC1_2 33 64 4.8e-13 PFAM
Pfam:RCC1 51 93 7.8e-13 PFAM
Meta Mutation Damage Score 0.672 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an N-terminal RCC1 domain and a C-terminal BTB (broad complex, tramtrack and bric-a-brac) domain. In rat, over-expression of this gene in vascular smooth muscle cells induced cellular hypertrophy. In rat, the C-terminus of RCBTB1 interacts with the angiotensin II receptor-1A. In humans, this gene maps to a region of chromosome 13q that is frequently deleted in B-cell chronic lymphocytic leukemia and other lymphoid malignancies. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,289,964 I2229T probably damaging Het
4930407I10Rik T C 15: 82,065,400 L1166P probably damaging Het
Actn4 T C 7: 28,912,236 probably null Het
Adamts17 A T 7: 67,120,939 E905V probably benign Het
Adck5 A G 15: 76,595,200 N485S probably damaging Het
Agr3 C A 12: 35,947,513 probably benign Het
Ankrd12 G A 17: 65,976,103 T1921I probably damaging Het
Ascl2 T C 7: 142,967,971 S247G probably benign Het
Atp7b T C 8: 22,020,864 E422G probably benign Het
C630050I24Rik C T 8: 107,119,262 R15* probably null Het
Cabin1 T G 10: 75,745,259 Q411P probably damaging Het
Chrne T C 11: 70,617,043 I277V possibly damaging Het
Coch A G 12: 51,601,812 probably null Het
Corin A G 5: 72,358,424 V429A probably damaging Het
Cpa3 A T 3: 20,225,117 N219K probably damaging Het
Creb3l1 T C 2: 91,991,211 E273G probably damaging Het
Csmd1 A C 8: 15,910,619 probably null Het
Ddx59 A G 1: 136,434,618 D527G probably damaging Het
Defa25 G A 8: 21,084,490 V17I probably null Het
Efs A G 14: 54,920,651 probably benign Het
Ern2 A G 7: 122,176,530 M447T probably benign Het
Fgfr2 C T 7: 130,177,755 E596K possibly damaging Het
Filip1 T C 9: 79,818,367 K990R probably benign Het
Ipo8 T A 6: 148,818,117 Q110L probably damaging Het
Kank4 T A 4: 98,771,280 I854F probably damaging Het
Mst1 G A 9: 108,084,853 C681Y probably damaging Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr1289 C T 2: 111,483,687 Q86* probably null Het
Olfr1496 A G 19: 13,781,422 E270G probably benign Het
Pde11a T C 2: 76,075,931 probably benign Het
Ptprq A G 10: 107,686,392 probably benign Het
Rpl37 G A 15: 5,117,694 R72H probably benign Het
Samd9l A T 6: 3,377,029 S77R possibly damaging Het
Sin3b A G 8: 72,733,439 D218G possibly damaging Het
Slc22a23 A G 13: 34,183,126 I633T probably damaging Het
Spen T C 4: 141,477,353 D1321G unknown Het
Ssh2 T C 11: 77,454,668 S1160P possibly damaging Het
Synrg T A 11: 84,023,406 D952E probably damaging Het
Tigd3 A G 19: 5,892,433 F223S probably damaging Het
Trim66 G A 7: 109,472,268 T608I possibly damaging Het
Trmt13 A G 3: 116,581,518 F447S probably damaging Het
Trpc2 T C 7: 102,088,279 I800T possibly damaging Het
Ugt3a2 A T 15: 9,370,098 I443F possibly damaging Het
Vamp2 C A 11: 69,089,174 P24Q unknown Het
Vmn1r113 A G 7: 20,787,712 Y143C probably benign Het
Vmn1r14 T A 6: 57,234,269 N277K probably benign Het
Vmn1r181 T A 7: 23,984,152 V14E probably damaging Het
Wdfy4 A T 14: 32,966,395 I3086N probably damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Rcbtb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Rcbtb1 APN 14 59228305 missense probably benign 0.19
IGL01954:Rcbtb1 APN 14 59229967 missense probably damaging 1.00
IGL02458:Rcbtb1 APN 14 59229994 missense probably damaging 1.00
IGL02632:Rcbtb1 APN 14 59224682 missense probably damaging 0.99
IGL02689:Rcbtb1 APN 14 59224700 missense probably damaging 1.00
IGL03201:Rcbtb1 APN 14 59223278 missense probably damaging 1.00
IGL03411:Rcbtb1 APN 14 59209970 start codon destroyed probably null 1.00
R0014:Rcbtb1 UTSW 14 59235242 missense probably benign 0.35
R2858:Rcbtb1 UTSW 14 59221412 splice site probably null
R2877:Rcbtb1 UTSW 14 59210592 splice site probably benign
R3890:Rcbtb1 UTSW 14 59228355 missense possibly damaging 0.67
R3892:Rcbtb1 UTSW 14 59228355 missense possibly damaging 0.67
R6869:Rcbtb1 UTSW 14 59217602 missense probably benign 0.01
R7224:Rcbtb1 UTSW 14 59228379 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCTAACAGTTGGTTGCC -3'
(R):5'- TACAAATCACAAGTGGGTGCCTC -3'

Sequencing Primer
(F):5'- AACAGTTGGTTGCCCTGCC -3'
(R):5'- TCACAAGTGGGTGCCTCAGAAG -3'
Posted On2015-04-17