Incidental Mutation 'R0376:Tmem161b'
ID30771
Institutional Source Beutler Lab
Gene Symbol Tmem161b
Ensembl Gene ENSMUSG00000035762
Gene Nametransmembrane protein 161B
Synonyms2810446P07Rik
MMRRC Submission 038582-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0376 (G1)
Quality Score208
Status Validated
Chromosome13
Chromosomal Location84222296-84296141 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84292383 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 125 (T125A)
Ref Sequence ENSEMBL: ENSMUSP00000152891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057495] [ENSMUST00000223827] [ENSMUST00000223862] [ENSMUST00000225069]
Predicted Effect probably benign
Transcript: ENSMUST00000057495
AA Change: T307A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000055208
Gene: ENSMUSG00000035762
AA Change: T307A

DomainStartEndE-ValueType
Pfam:Tmemb_161AB 2 485 1.3e-213 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223827
Predicted Effect probably benign
Transcript: ENSMUST00000223862
Predicted Effect probably benign
Transcript: ENSMUST00000225069
AA Change: T125A

PolyPhen 2 Score 0.426 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.0%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Homozygous mice exhibit lethality before genotyping age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik G A 2: 173,528,327 E132K probably benign Het
Adam6a T C 12: 113,544,690 Y228H probably damaging Het
Als2 A G 1: 59,215,565 F211S probably benign Het
Ankrd12 T A 17: 66,053,009 Q11L probably damaging Het
Anxa5 T C 3: 36,460,488 R115G probably damaging Het
Arhgap10 T C 8: 77,450,824 probably benign Het
Atp2a3 T A 11: 72,982,702 D782E probably damaging Het
Bcr G T 10: 75,145,327 L659F probably damaging Het
Cacna1b A G 2: 24,659,003 probably benign Het
Camp C T 9: 109,848,399 C122Y probably damaging Het
Col12a1 A T 9: 79,693,494 S769R probably benign Het
Cyp2j6 T A 4: 96,526,023 K335I probably damaging Het
Cyp3a11 A C 5: 145,862,452 Y308* probably null Het
Flnb G A 14: 7,946,014 probably null Het
Frmd4a G T 2: 4,572,387 M351I probably damaging Het
Gabrg2 C T 11: 41,916,315 S365N possibly damaging Het
Ggn T C 7: 29,173,022 V609A possibly damaging Het
H60c T C 10: 3,260,435 probably benign Het
Hexdc T A 11: 121,218,165 probably benign Het
Igsf9b A G 9: 27,334,582 T1282A probably benign Het
Ikzf4 T C 10: 128,632,756 N618S probably benign Het
Ints14 A G 9: 64,983,990 K418E probably damaging Het
Iqgap1 T C 7: 80,723,879 E1454G probably benign Het
Kif13b T C 14: 64,757,404 probably benign Het
Krt71 A C 15: 101,738,070 F328C probably damaging Het
Lama2 T C 10: 27,015,546 T2524A possibly damaging Het
Mfn2 C T 4: 147,885,526 V363I probably benign Het
Mkln1 A T 6: 31,478,018 D496V probably benign Het
Olfr450 A T 6: 42,818,292 M274L probably benign Het
Patj T A 4: 98,568,987 I1242N probably damaging Het
Pcnx C T 12: 81,974,579 probably benign Het
Plcb2 T C 2: 118,717,240 E502G probably damaging Het
Plppr4 G T 3: 117,323,091 H314Q probably benign Het
Prkcsh A G 9: 22,010,251 probably benign Het
Prr14 C T 7: 127,476,643 H181Y probably benign Het
Pus3 A T 9: 35,566,422 M317L possibly damaging Het
Pwwp2a T A 11: 43,704,672 D221E probably benign Het
Rbm15 T C 3: 107,330,938 S715G probably benign Het
Rbm28 A G 6: 29,158,928 probably benign Het
Rhobtb2 A T 14: 69,796,735 V347E probably benign Het
Rimbp2 C T 5: 128,803,861 R161Q probably damaging Het
Scgb1b27 C T 7: 34,021,897 T70I possibly damaging Het
Slc40a1 T C 1: 45,912,491 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spaca9 A G 2: 28,693,660 V104A probably benign Het
Spag7 T C 11: 70,669,190 probably benign Het
Sugp1 A G 8: 70,052,638 D85G probably damaging Het
Sun1 A G 5: 139,226,699 probably benign Het
Tcp11l1 C A 2: 104,697,505 probably benign Het
Tead3 A C 17: 28,341,365 D88E probably damaging Het
Tecpr1 A T 5: 144,207,476 V636E possibly damaging Het
Tldc2 T C 2: 157,095,305 W147R probably damaging Het
Trrap A G 5: 144,816,339 M1825V probably benign Het
Ttbk2 A G 2: 120,777,581 F186L probably damaging Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Zc3h7a T C 16: 11,156,202 M240V probably benign Het
Zc3hc1 G C 6: 30,372,790 S351W probably damaging Het
Zfp366 T C 13: 99,234,251 M493T probably benign Het
Zfp93 C T 7: 24,275,861 P424S probably damaging Het
Other mutations in Tmem161b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Tmem161b APN 13 84294596 splice site probably benign
IGL01086:Tmem161b APN 13 84222422 utr 5 prime probably benign
IGL01150:Tmem161b APN 13 84292407 nonsense probably null
IGL01566:Tmem161b APN 13 84294762 missense probably benign 0.35
IGL02183:Tmem161b APN 13 84272254 missense probably damaging 1.00
IGL02481:Tmem161b APN 13 84283993 missense probably damaging 0.99
IGL02519:Tmem161b APN 13 84294744 missense probably damaging 1.00
IGL03207:Tmem161b APN 13 84294595 splice site probably benign
R0015:Tmem161b UTSW 13 84222414 utr 5 prime probably null
R0613:Tmem161b UTSW 13 84251320 missense probably damaging 1.00
R1925:Tmem161b UTSW 13 84260229 missense probably benign 0.07
R1935:Tmem161b UTSW 13 84293466 missense probably damaging 1.00
R1936:Tmem161b UTSW 13 84293466 missense probably damaging 1.00
R2325:Tmem161b UTSW 13 84294768 missense possibly damaging 0.94
R2988:Tmem161b UTSW 13 84292455 nonsense probably null
R4327:Tmem161b UTSW 13 84251240 missense probably damaging 1.00
R4525:Tmem161b UTSW 13 84257802 missense probably benign 0.00
R4558:Tmem161b UTSW 13 84251244 missense possibly damaging 0.50
R5133:Tmem161b UTSW 13 84294768 missense possibly damaging 0.94
R5134:Tmem161b UTSW 13 84294768 missense possibly damaging 0.94
R5727:Tmem161b UTSW 13 84286790 missense possibly damaging 0.63
R5875:Tmem161b UTSW 13 84294858 missense probably damaging 1.00
R6217:Tmem161b UTSW 13 84251244 missense possibly damaging 0.50
R6527:Tmem161b UTSW 13 84272264 missense probably benign 0.06
R6550:Tmem161b UTSW 13 84222418 start gained probably benign
R6551:Tmem161b UTSW 13 84222418 start gained probably benign
R6553:Tmem161b UTSW 13 84222418 start gained probably benign
R6554:Tmem161b UTSW 13 84222418 start gained probably benign
R6640:Tmem161b UTSW 13 84222418 start gained probably benign
R6641:Tmem161b UTSW 13 84222418 start gained probably benign
R6685:Tmem161b UTSW 13 84222418 start gained probably benign
R6836:Tmem161b UTSW 13 84222418 start gained probably benign
R6837:Tmem161b UTSW 13 84222418 start gained probably benign
R6838:Tmem161b UTSW 13 84222418 start gained probably benign
R7077:Tmem161b UTSW 13 84222418 start gained probably benign
R7078:Tmem161b UTSW 13 84222418 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGCGACCATTCAGACTTACTGCCC -3'
(R):5'- TGACACATAAGCCCCTTTCAGCG -3'

Sequencing Primer
(F):5'- TTCCTAGCCATAGGTAGATAGTAAGG -3'
(R):5'- CCTTTCAGCGGCAGAATTG -3'
Posted On2013-04-24