Incidental Mutation 'R0376:Zfp366'
ID30772
Institutional Source Beutler Lab
Gene Symbol Zfp366
Ensembl Gene ENSMUSG00000050919
Gene Namezinc finger protein 366
SynonymsDC-SCRIPT
MMRRC Submission 038582-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.355) question?
Stock #R0376 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location99184823-99250656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99234251 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 493 (M493T)
Ref Sequence ENSEMBL: ENSMUSP00000060040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056558]
Predicted Effect probably benign
Transcript: ENSMUST00000056558
AA Change: M493T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000060040
Gene: ENSMUSG00000050919
AA Change: M493T

DomainStartEndE-ValueType
low complexity region 159 175 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
ZnF_C2H2 250 272 1.18e-2 SMART
ZnF_C2H2 278 300 4.05e-1 SMART
ZnF_C2H2 306 328 1.79e-2 SMART
ZnF_C2H2 334 356 1.53e-1 SMART
ZnF_C2H2 362 384 1.89e-1 SMART
ZnF_C2H2 390 412 1.22e-4 SMART
ZnF_C2H2 418 440 1.36e-2 SMART
ZnF_C2H2 446 468 1.1e-2 SMART
ZnF_C2H2 474 496 8.34e-3 SMART
ZnF_C2H2 502 524 5.42e-2 SMART
ZnF_C2H2 530 553 2.4e-3 SMART
low complexity region 615 623 N/A INTRINSIC
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.0%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit perimembranous and muscular ventricular septal defects (VSD), and overriding aorta. Short snout, micrognathia, micropthalmia, hypoplastic thymus, and hydronephrosis are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik G A 2: 173,528,327 E132K probably benign Het
Adam6a T C 12: 113,544,690 Y228H probably damaging Het
Als2 A G 1: 59,215,565 F211S probably benign Het
Ankrd12 T A 17: 66,053,009 Q11L probably damaging Het
Anxa5 T C 3: 36,460,488 R115G probably damaging Het
Arhgap10 T C 8: 77,450,824 probably benign Het
Atp2a3 T A 11: 72,982,702 D782E probably damaging Het
Bcr G T 10: 75,145,327 L659F probably damaging Het
Cacna1b A G 2: 24,659,003 probably benign Het
Camp C T 9: 109,848,399 C122Y probably damaging Het
Col12a1 A T 9: 79,693,494 S769R probably benign Het
Cyp2j6 T A 4: 96,526,023 K335I probably damaging Het
Cyp3a11 A C 5: 145,862,452 Y308* probably null Het
Flnb G A 14: 7,946,014 probably null Het
Frmd4a G T 2: 4,572,387 M351I probably damaging Het
Gabrg2 C T 11: 41,916,315 S365N possibly damaging Het
Ggn T C 7: 29,173,022 V609A possibly damaging Het
H60c T C 10: 3,260,435 probably benign Het
Hexdc T A 11: 121,218,165 probably benign Het
Igsf9b A G 9: 27,334,582 T1282A probably benign Het
Ikzf4 T C 10: 128,632,756 N618S probably benign Het
Ints14 A G 9: 64,983,990 K418E probably damaging Het
Iqgap1 T C 7: 80,723,879 E1454G probably benign Het
Kif13b T C 14: 64,757,404 probably benign Het
Krt71 A C 15: 101,738,070 F328C probably damaging Het
Lama2 T C 10: 27,015,546 T2524A possibly damaging Het
Mfn2 C T 4: 147,885,526 V363I probably benign Het
Mkln1 A T 6: 31,478,018 D496V probably benign Het
Olfr450 A T 6: 42,818,292 M274L probably benign Het
Patj T A 4: 98,568,987 I1242N probably damaging Het
Pcnx C T 12: 81,974,579 probably benign Het
Plcb2 T C 2: 118,717,240 E502G probably damaging Het
Plppr4 G T 3: 117,323,091 H314Q probably benign Het
Prkcsh A G 9: 22,010,251 probably benign Het
Prr14 C T 7: 127,476,643 H181Y probably benign Het
Pus3 A T 9: 35,566,422 M317L possibly damaging Het
Pwwp2a T A 11: 43,704,672 D221E probably benign Het
Rbm15 T C 3: 107,330,938 S715G probably benign Het
Rbm28 A G 6: 29,158,928 probably benign Het
Rhobtb2 A T 14: 69,796,735 V347E probably benign Het
Rimbp2 C T 5: 128,803,861 R161Q probably damaging Het
Scgb1b27 C T 7: 34,021,897 T70I possibly damaging Het
Slc40a1 T C 1: 45,912,491 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spaca9 A G 2: 28,693,660 V104A probably benign Het
Spag7 T C 11: 70,669,190 probably benign Het
Sugp1 A G 8: 70,052,638 D85G probably damaging Het
Sun1 A G 5: 139,226,699 probably benign Het
Tcp11l1 C A 2: 104,697,505 probably benign Het
Tead3 A C 17: 28,341,365 D88E probably damaging Het
Tecpr1 A T 5: 144,207,476 V636E possibly damaging Het
Tldc2 T C 2: 157,095,305 W147R probably damaging Het
Tmem161b A G 13: 84,292,383 T125A probably benign Het
Trrap A G 5: 144,816,339 M1825V probably benign Het
Ttbk2 A G 2: 120,777,581 F186L probably damaging Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Zc3h7a T C 16: 11,156,202 M240V probably benign Het
Zc3hc1 G C 6: 30,372,790 S351W probably damaging Het
Zfp93 C T 7: 24,275,861 P424S probably damaging Het
Other mutations in Zfp366
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Zfp366 APN 13 99246572 utr 3 prime probably benign
IGL01626:Zfp366 APN 13 99228412 missense probably damaging 0.99
IGL02227:Zfp366 APN 13 99234188 missense possibly damaging 0.85
IGL03074:Zfp366 APN 13 99246405 missense probably benign
R0126:Zfp366 UTSW 13 99228621 missense probably benign 0.14
R0145:Zfp366 UTSW 13 99229540 missense probably damaging 1.00
R0234:Zfp366 UTSW 13 99234260 missense probably damaging 1.00
R0234:Zfp366 UTSW 13 99234260 missense probably damaging 1.00
R0537:Zfp366 UTSW 13 99229278 missense probably damaging 1.00
R0637:Zfp366 UTSW 13 99228966 missense probably damaging 0.99
R0838:Zfp366 UTSW 13 99228610 missense possibly damaging 0.73
R1386:Zfp366 UTSW 13 99246555 missense probably damaging 0.98
R1422:Zfp366 UTSW 13 99229296 missense probably damaging 1.00
R1669:Zfp366 UTSW 13 99229561 missense probably damaging 0.99
R1839:Zfp366 UTSW 13 99228492 missense probably damaging 0.98
R3751:Zfp366 UTSW 13 99228844 missense probably damaging 1.00
R4782:Zfp366 UTSW 13 99246483 missense probably damaging 1.00
R4908:Zfp366 UTSW 13 99234101 missense possibly damaging 0.68
R4992:Zfp366 UTSW 13 99229495 missense possibly damaging 0.62
R5040:Zfp366 UTSW 13 99228367 missense probably damaging 1.00
R5086:Zfp366 UTSW 13 99228943 missense probably benign 0.00
R5186:Zfp366 UTSW 13 99246168 missense probably benign 0.00
R5249:Zfp366 UTSW 13 99229609 missense probably damaging 1.00
R5450:Zfp366 UTSW 13 99229585 missense probably damaging 1.00
R6838:Zfp366 UTSW 13 99228507 missense possibly damaging 0.93
R6838:Zfp366 UTSW 13 99246177 missense possibly damaging 0.83
R7250:Zfp366 UTSW 13 99229568 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTGGTTGTGAATCTTGCCTCTG -3'
(R):5'- CCCTGAACTAAGCAGTTAGGCCAC -3'

Sequencing Primer
(F):5'- TGCTGGCCAACATGAAGA -3'
(R):5'- GAAGGACCGCTGTGAGC -3'
Posted On2013-04-24