Incidental Mutation 'R0376:Rhobtb2'
ID30775
Institutional Source Beutler Lab
Gene Symbol Rhobtb2
Ensembl Gene ENSMUSG00000022075
Gene NameRho-related BTB domain containing 2
SynonymsDbc2, E130206H14Rik
MMRRC Submission 038582-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0376 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location69784990-69805636 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69796735 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 347 (V347E)
Ref Sequence ENSEMBL: ENSMUSP00000022665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022665]
Predicted Effect probably benign
Transcript: ENSMUST00000022665
AA Change: V347E

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022665
Gene: ENSMUSG00000022075
AA Change: V347E

DomainStartEndE-ValueType
RHO 17 210 4.86e-36 SMART
low complexity region 227 249 N/A INTRINSIC
BTB 266 472 5.27e-15 SMART
BTB 500 598 2.78e-14 SMART
low complexity region 706 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225088
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.0%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a small Rho GTPase and a candidate tumor suppressor. The encoded protein interacts with the cullin-3 protein, a ubiquitin E3 ligase necessary for mitotic cell division. This protein inhibits the growth and spread of some types of breast cancer. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik G A 2: 173,528,327 E132K probably benign Het
Adam6a T C 12: 113,544,690 Y228H probably damaging Het
Als2 A G 1: 59,215,565 F211S probably benign Het
Ankrd12 T A 17: 66,053,009 Q11L probably damaging Het
Anxa5 T C 3: 36,460,488 R115G probably damaging Het
Arhgap10 T C 8: 77,450,824 probably benign Het
Atp2a3 T A 11: 72,982,702 D782E probably damaging Het
Bcr G T 10: 75,145,327 L659F probably damaging Het
Cacna1b A G 2: 24,659,003 probably benign Het
Camp C T 9: 109,848,399 C122Y probably damaging Het
Col12a1 A T 9: 79,693,494 S769R probably benign Het
Cyp2j6 T A 4: 96,526,023 K335I probably damaging Het
Cyp3a11 A C 5: 145,862,452 Y308* probably null Het
Flnb G A 14: 7,946,014 probably null Het
Frmd4a G T 2: 4,572,387 M351I probably damaging Het
Gabrg2 C T 11: 41,916,315 S365N possibly damaging Het
Ggn T C 7: 29,173,022 V609A possibly damaging Het
H60c T C 10: 3,260,435 probably benign Het
Hexdc T A 11: 121,218,165 probably benign Het
Igsf9b A G 9: 27,334,582 T1282A probably benign Het
Ikzf4 T C 10: 128,632,756 N618S probably benign Het
Ints14 A G 9: 64,983,990 K418E probably damaging Het
Iqgap1 T C 7: 80,723,879 E1454G probably benign Het
Kif13b T C 14: 64,757,404 probably benign Het
Krt71 A C 15: 101,738,070 F328C probably damaging Het
Lama2 T C 10: 27,015,546 T2524A possibly damaging Het
Mfn2 C T 4: 147,885,526 V363I probably benign Het
Mkln1 A T 6: 31,478,018 D496V probably benign Het
Olfr450 A T 6: 42,818,292 M274L probably benign Het
Patj T A 4: 98,568,987 I1242N probably damaging Het
Pcnx C T 12: 81,974,579 probably benign Het
Plcb2 T C 2: 118,717,240 E502G probably damaging Het
Plppr4 G T 3: 117,323,091 H314Q probably benign Het
Prkcsh A G 9: 22,010,251 probably benign Het
Prr14 C T 7: 127,476,643 H181Y probably benign Het
Pus3 A T 9: 35,566,422 M317L possibly damaging Het
Pwwp2a T A 11: 43,704,672 D221E probably benign Het
Rbm15 T C 3: 107,330,938 S715G probably benign Het
Rbm28 A G 6: 29,158,928 probably benign Het
Rimbp2 C T 5: 128,803,861 R161Q probably damaging Het
Scgb1b27 C T 7: 34,021,897 T70I possibly damaging Het
Slc40a1 T C 1: 45,912,491 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spaca9 A G 2: 28,693,660 V104A probably benign Het
Spag7 T C 11: 70,669,190 probably benign Het
Sugp1 A G 8: 70,052,638 D85G probably damaging Het
Sun1 A G 5: 139,226,699 probably benign Het
Tcp11l1 C A 2: 104,697,505 probably benign Het
Tead3 A C 17: 28,341,365 D88E probably damaging Het
Tecpr1 A T 5: 144,207,476 V636E possibly damaging Het
Tldc2 T C 2: 157,095,305 W147R probably damaging Het
Tmem161b A G 13: 84,292,383 T125A probably benign Het
Trrap A G 5: 144,816,339 M1825V probably benign Het
Ttbk2 A G 2: 120,777,581 F186L probably damaging Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Zc3h7a T C 16: 11,156,202 M240V probably benign Het
Zc3hc1 G C 6: 30,372,790 S351W probably damaging Het
Zfp366 T C 13: 99,234,251 M493T probably benign Het
Zfp93 C T 7: 24,275,861 P424S probably damaging Het
Other mutations in Rhobtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01482:Rhobtb2 APN 14 69796588 missense possibly damaging 0.82
IGL02437:Rhobtb2 APN 14 69795916 missense probably damaging 1.00
Paunchy UTSW 14 69798178 missense probably damaging 1.00
reeses UTSW 14 69799711 missense probably damaging 1.00
smoke UTSW 14 69796444 missense probably damaging 0.99
waft UTSW 14 69796735 missense probably benign 0.22
R0034:Rhobtb2 UTSW 14 69788688 missense probably benign
R0149:Rhobtb2 UTSW 14 69795908 missense probably benign 0.02
R0361:Rhobtb2 UTSW 14 69795908 missense probably benign 0.02
R0594:Rhobtb2 UTSW 14 69793948 missense probably benign
R1005:Rhobtb2 UTSW 14 69798277 missense probably damaging 1.00
R1072:Rhobtb2 UTSW 14 69787527 small deletion probably benign
R1929:Rhobtb2 UTSW 14 69796444 missense probably damaging 0.99
R1938:Rhobtb2 UTSW 14 69796613 missense probably benign 0.01
R2058:Rhobtb2 UTSW 14 69794039 missense possibly damaging 0.49
R2244:Rhobtb2 UTSW 14 69787527 small deletion probably benign
R2992:Rhobtb2 UTSW 14 69798323 missense probably damaging 1.00
R3953:Rhobtb2 UTSW 14 69794039 missense possibly damaging 0.49
R4655:Rhobtb2 UTSW 14 69795989 missense probably damaging 0.97
R4712:Rhobtb2 UTSW 14 69799711 missense probably damaging 1.00
R4744:Rhobtb2 UTSW 14 69794002 missense probably damaging 1.00
R4771:Rhobtb2 UTSW 14 69797050 missense probably benign 0.20
R5648:Rhobtb2 UTSW 14 69797144 missense probably damaging 1.00
R5990:Rhobtb2 UTSW 14 69796369 missense probably damaging 1.00
R6166:Rhobtb2 UTSW 14 69798178 missense probably damaging 1.00
R6186:Rhobtb2 UTSW 14 69798244 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCGGCTGAATGGAGTTATCCATC -3'
(R):5'- GCGCATCTTTGCCCACAAAATCTAC -3'

Sequencing Primer
(F):5'- CCATCAGCCGGGATTTGAAG -3'
(R):5'- TTGCCCACAAAATCTACCTCTC -3'
Posted On2013-04-24