Incidental Mutation 'R3947:Acin1'
ID307762
Institutional Source Beutler Lab
Gene Symbol Acin1
Ensembl Gene ENSMUSG00000022185
Gene Nameapoptotic chromatin condensation inducer 1
Synonyms2610510L13Rik, Acinus, 2610036I19Rik
MMRRC Submission 040927-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R3947 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location54642161-54686931 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54679333 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 133 (Q133L)
Ref Sequence ENSEMBL: ENSMUSP00000107109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022793] [ENSMUST00000111484] [ENSMUST00000125265]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022793
AA Change: Q133L

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022793
Gene: ENSMUSG00000022185
AA Change: Q133L

DomainStartEndE-ValueType
SAP 72 106 1.29e-8 SMART
coiled coil region 138 175 N/A INTRINSIC
low complexity region 205 220 N/A INTRINSIC
coiled coil region 259 300 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 414 423 N/A INTRINSIC
low complexity region 573 603 N/A INTRINSIC
low complexity region 631 662 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
low complexity region 760 773 N/A INTRINSIC
low complexity region 778 792 N/A INTRINSIC
low complexity region 803 813 N/A INTRINSIC
internal_repeat_1 817 892 1.63e-6 PROSPERO
low complexity region 927 952 N/A INTRINSIC
RRM 1012 1081 8.3e-2 SMART
Pfam:RSB_motif 1139 1246 5.7e-30 PFAM
low complexity region 1275 1329 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111484
AA Change: Q133L

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107109
Gene: ENSMUSG00000022185
AA Change: Q133L

DomainStartEndE-ValueType
SAP 72 106 1.29e-8 SMART
coiled coil region 138 172 N/A INTRINSIC
coiled coil region 219 260 N/A INTRINSIC
low complexity region 338 356 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 591 622 N/A INTRINSIC
low complexity region 694 703 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
low complexity region 738 752 N/A INTRINSIC
low complexity region 763 773 N/A INTRINSIC
internal_repeat_1 777 852 1.21e-6 PROSPERO
low complexity region 887 912 N/A INTRINSIC
RRM 972 1041 8.3e-2 SMART
low complexity region 1073 1123 N/A INTRINSIC
low complexity region 1130 1168 N/A INTRINSIC
coiled coil region 1188 1253 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000125265
AA Change: Q27L

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120445
Gene: ENSMUSG00000022185
AA Change: Q27L

DomainStartEndE-ValueType
Blast:BRLZ 1 27 3e-9 BLAST
coiled coil region 32 66 N/A INTRINSIC
coiled coil region 113 154 N/A INTRINSIC
low complexity region 232 250 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134808
Predicted Effect unknown
Transcript: ENSMUST00000147714
AA Change: Q78L
SMART Domains Protein: ENSMUSP00000119080
Gene: ENSMUSG00000022185
AA Change: Q78L

DomainStartEndE-ValueType
SAP 18 52 1.29e-8 SMART
coiled coil region 83 120 N/A INTRINSIC
low complexity region 151 166 N/A INTRINSIC
coiled coil region 204 245 N/A INTRINSIC
low complexity region 324 342 N/A INTRINSIC
low complexity region 360 369 N/A INTRINSIC
low complexity region 519 549 N/A INTRINSIC
low complexity region 577 608 N/A INTRINSIC
low complexity region 680 689 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
low complexity region 724 738 N/A INTRINSIC
low complexity region 749 759 N/A INTRINSIC
low complexity region 861 886 N/A INTRINSIC
RRM 946 1015 8.3e-2 SMART
Pfam:RSB_motif 1065 1180 1.1e-29 PFAM
low complexity region 1209 1263 N/A INTRINSIC
Meta Mutation Damage Score 0.41 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apoptosis is defined by several morphologic nuclear changes, including chromatin condensation and nuclear fragmentation. This gene encodes a nuclear protein that induces apoptotic chromatin condensation after activation by caspase-3, without inducing DNA fragmentation. This protein has also been shown to be a component of a splicing-dependent multiprotein exon junction complex (EJC) that is deposited at splice junctions on mRNAs, as a consequence of pre-mRNA splicing. It may thus be involved in mRNA metabolism associated with splicing. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 C T X: 56,917,754 T1561I probably benign Het
Avl9 T C 6: 56,728,665 probably null Het
C87436 T A 6: 86,446,186 H247Q probably damaging Het
Cfap43 G T 19: 47,765,979 H969N probably benign Het
Chst15 T A 7: 132,247,875 N446Y probably damaging Het
Col4a3 T A 1: 82,715,332 I1446N probably damaging Het
Disc1 A G 8: 125,088,135 E246G probably damaging Het
Dyrk4 A G 6: 126,885,305 I408T probably damaging Het
Fnbp1l G T 3: 122,544,579 A481D possibly damaging Het
Gm10608 TACACACACACACACACACACACACACACACACACACACACACACACACACACACA TACACACACACACACACACACACACACACACACACACACACACACACACA 9: 119,160,662 probably benign Het
Grk2 G A 19: 4,292,417 T129M possibly damaging Het
Ino80d G T 1: 63,074,503 Q263K probably benign Het
Iqsec3 A T 6: 121,387,824 Y835* probably null Het
Irak3 T A 10: 120,170,373 M213L probably benign Het
Macf1 T C 4: 123,380,420 R6388G probably damaging Het
Mtnr1a T C 8: 45,087,520 Y173H probably damaging Het
Myo5b C T 18: 74,695,403 R709W probably damaging Het
Nebl A T 2: 17,378,106 probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr123 A T 17: 37,796,115 I224L probably benign Het
Pex11g G A 8: 3,465,787 T82I probably benign Het
Pgr A G 9: 8,961,452 I842V probably benign Het
Pkd1 T A 17: 24,578,037 probably benign Het
Rbm20 T C 19: 53,813,337 I92T probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Ssh2 A G 11: 77,398,256 D88G probably damaging Het
Suclg2 G T 6: 95,579,238 probably null Het
Tdrd3 A T 14: 87,506,599 D655V probably damaging Het
Tex2 C T 11: 106,520,003 D896N unknown Het
Tmem168 C A 6: 13,583,052 R610L probably damaging Het
Ttc17 A G 2: 94,376,146 probably benign Het
Vmn2r99 T C 17: 19,378,990 M312T probably benign Het
Wdfy3 T C 5: 101,870,036 E2546G probably damaging Het
Other mutations in Acin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Acin1 APN 14 54646800 missense probably damaging 1.00
IGL01530:Acin1 APN 14 54643986 missense probably damaging 1.00
IGL02396:Acin1 APN 14 54644799 intron probably benign
IGL02967:Acin1 APN 14 54642753 missense possibly damaging 0.80
Protuberant UTSW 14 54645283 missense probably damaging 1.00
R0411:Acin1 UTSW 14 54646774 missense probably damaging 1.00
R0723:Acin1 UTSW 14 54665451 missense probably damaging 0.98
R0755:Acin1 UTSW 14 54651835 start codon destroyed probably null 0.93
R0784:Acin1 UTSW 14 54653528 unclassified probably benign
R1600:Acin1 UTSW 14 54643717 intron probably benign
R1682:Acin1 UTSW 14 54663718 missense probably damaging 1.00
R1721:Acin1 UTSW 14 54664538 missense probably benign 0.01
R1756:Acin1 UTSW 14 54665204 missense probably benign 0.30
R1867:Acin1 UTSW 14 54644261 missense probably damaging 1.00
R1997:Acin1 UTSW 14 54646699 splice site probably null
R2067:Acin1 UTSW 14 54665254 missense probably damaging 1.00
R4374:Acin1 UTSW 14 54653894 unclassified probably benign
R4476:Acin1 UTSW 14 54645330 missense probably damaging 1.00
R4501:Acin1 UTSW 14 54686587 missense probably damaging 1.00
R4547:Acin1 UTSW 14 54645667 missense probably benign 0.01
R4621:Acin1 UTSW 14 54653443 unclassified probably benign
R4657:Acin1 UTSW 14 54643047 missense possibly damaging 0.93
R4680:Acin1 UTSW 14 54686758 missense probably benign 0.00
R4696:Acin1 UTSW 14 54643017 intron probably benign
R4806:Acin1 UTSW 14 54679228 splice site probably benign
R4826:Acin1 UTSW 14 54664617 missense probably damaging 0.97
R5096:Acin1 UTSW 14 54679222 intron probably benign
R5153:Acin1 UTSW 14 54645613 missense probably benign 0.25
R5223:Acin1 UTSW 14 54642941 frame shift probably null
R5260:Acin1 UTSW 14 54642822 intron probably benign
R5525:Acin1 UTSW 14 54664391 missense possibly damaging 0.94
R5575:Acin1 UTSW 14 54678738 splice site probably null
R5902:Acin1 UTSW 14 54663673 missense probably benign 0.01
R6211:Acin1 UTSW 14 54644046 missense probably damaging 1.00
R6524:Acin1 UTSW 14 54645283 missense probably damaging 1.00
R6560:Acin1 UTSW 14 54678833 missense probably benign 0.24
R6916:Acin1 UTSW 14 54665416 missense probably benign 0.27
R7201:Acin1 UTSW 14 54664899 missense possibly damaging 0.83
X0021:Acin1 UTSW 14 54667101 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGAGCAGCAGTCTTCCC -3'
(R):5'- CACATTGCTTGGACTGGGTG -3'

Sequencing Primer
(F):5'- CTGACCTCTTCCTGGAATTAGTTAG -3'
(R):5'- TTTATGCACATATCCATGACAAAAAC -3'
Posted On2015-04-17