Incidental Mutation 'R0376:Zc3h7a'
ID30777
Institutional Source Beutler Lab
Gene Symbol Zc3h7a
Ensembl Gene ENSMUSG00000037965
Gene Namezinc finger CCCH type containing 7 A
SynonymsZc3h7, A430104C18Rik
MMRRC Submission 038582-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R0376 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location11136592-11176393 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11156202 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 240 (M240V)
Ref Sequence ENSEMBL: ENSMUSP00000120720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037633] [ENSMUST00000125537] [ENSMUST00000128083] [ENSMUST00000130355] [ENSMUST00000138185] [ENSMUST00000140755] [ENSMUST00000142389]
Predicted Effect probably benign
Transcript: ENSMUST00000037633
AA Change: M240V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041308
Gene: ENSMUSG00000037965
AA Change: M240V

DomainStartEndE-ValueType
PDB:2DBA|A 26 157 9e-7 PDB
Blast:TPR 43 76 1e-7 BLAST
SCOP:d1ihga1 46 169 1e-11 SMART
Blast:TPR 124 156 9e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 380 398 N/A INTRINSIC
ZnF_C2H2 443 467 1.83e2 SMART
ZnF_C3H1 630 654 1.57e1 SMART
ZnF_C3H1 770 795 8.81e0 SMART
ZnF_C2H2 856 880 1.62e0 SMART
ZnF_C3H1 902 926 1.76e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125537
SMART Domains Protein: ENSMUSP00000122525
Gene: ENSMUSG00000037965

DomainStartEndE-ValueType
Blast:TPR 43 76 2e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000128083
AA Change: M240V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114246
Gene: ENSMUSG00000037965
AA Change: M240V

DomainStartEndE-ValueType
Pfam:TPR_11 41 120 2.7e-8 PFAM
Blast:TPR 124 156 4e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 380 398 N/A INTRINSIC
Blast:ZnF_C2H2 443 467 2e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000130355
SMART Domains Protein: ENSMUSP00000120931
Gene: ENSMUSG00000037965

DomainStartEndE-ValueType
Pfam:TPR_11 41 120 4.4e-9 PFAM
Blast:TPR 124 156 2e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000138185
AA Change: M240V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119480
Gene: ENSMUSG00000037965
AA Change: M240V

DomainStartEndE-ValueType
Pfam:TPR_11 41 120 3.9e-8 PFAM
Blast:TPR 124 156 6e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 380 398 N/A INTRINSIC
Blast:ZnF_C2H2 443 467 4e-10 BLAST
Blast:ZnF_C3H1 628 654 5e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139391
Predicted Effect probably benign
Transcript: ENSMUST00000140755
AA Change: M240V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120720
Gene: ENSMUSG00000037965
AA Change: M240V

DomainStartEndE-ValueType
Pfam:TPR_11 41 120 1e-7 PFAM
Blast:TPR 124 156 5e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140775
Predicted Effect probably benign
Transcript: ENSMUST00000142389
SMART Domains Protein: ENSMUSP00000114432
Gene: ENSMUSG00000037965

DomainStartEndE-ValueType
Blast:TPR 43 76 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155343
Meta Mutation Damage Score 0.014 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.0%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik G A 2: 173,528,327 E132K probably benign Het
Adam6a T C 12: 113,544,690 Y228H probably damaging Het
Als2 A G 1: 59,215,565 F211S probably benign Het
Ankrd12 T A 17: 66,053,009 Q11L probably damaging Het
Anxa5 T C 3: 36,460,488 R115G probably damaging Het
Arhgap10 T C 8: 77,450,824 probably benign Het
Atp2a3 T A 11: 72,982,702 D782E probably damaging Het
Bcr G T 10: 75,145,327 L659F probably damaging Het
Cacna1b A G 2: 24,659,003 probably benign Het
Camp C T 9: 109,848,399 C122Y probably damaging Het
Col12a1 A T 9: 79,693,494 S769R probably benign Het
Cyp2j6 T A 4: 96,526,023 K335I probably damaging Het
Cyp3a11 A C 5: 145,862,452 Y308* probably null Het
Flnb G A 14: 7,946,014 probably null Het
Frmd4a G T 2: 4,572,387 M351I probably damaging Het
Gabrg2 C T 11: 41,916,315 S365N possibly damaging Het
Ggn T C 7: 29,173,022 V609A possibly damaging Het
H60c T C 10: 3,260,435 probably benign Het
Hexdc T A 11: 121,218,165 probably benign Het
Igsf9b A G 9: 27,334,582 T1282A probably benign Het
Ikzf4 T C 10: 128,632,756 N618S probably benign Het
Ints14 A G 9: 64,983,990 K418E probably damaging Het
Iqgap1 T C 7: 80,723,879 E1454G probably benign Het
Kif13b T C 14: 64,757,404 probably benign Het
Krt71 A C 15: 101,738,070 F328C probably damaging Het
Lama2 T C 10: 27,015,546 T2524A possibly damaging Het
Mfn2 C T 4: 147,885,526 V363I probably benign Het
Mkln1 A T 6: 31,478,018 D496V probably benign Het
Olfr450 A T 6: 42,818,292 M274L probably benign Het
Patj T A 4: 98,568,987 I1242N probably damaging Het
Pcnx C T 12: 81,974,579 probably benign Het
Plcb2 T C 2: 118,717,240 E502G probably damaging Het
Plppr4 G T 3: 117,323,091 H314Q probably benign Het
Prkcsh A G 9: 22,010,251 probably benign Het
Prr14 C T 7: 127,476,643 H181Y probably benign Het
Pus3 A T 9: 35,566,422 M317L possibly damaging Het
Pwwp2a T A 11: 43,704,672 D221E probably benign Het
Rbm15 T C 3: 107,330,938 S715G probably benign Het
Rbm28 A G 6: 29,158,928 probably benign Het
Rhobtb2 A T 14: 69,796,735 V347E probably benign Het
Rimbp2 C T 5: 128,803,861 R161Q probably damaging Het
Scgb1b27 C T 7: 34,021,897 T70I possibly damaging Het
Slc40a1 T C 1: 45,912,491 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spaca9 A G 2: 28,693,660 V104A probably benign Het
Spag7 T C 11: 70,669,190 probably benign Het
Sugp1 A G 8: 70,052,638 D85G probably damaging Het
Sun1 A G 5: 139,226,699 probably benign Het
Tcp11l1 C A 2: 104,697,505 probably benign Het
Tead3 A C 17: 28,341,365 D88E probably damaging Het
Tecpr1 A T 5: 144,207,476 V636E possibly damaging Het
Tldc2 T C 2: 157,095,305 W147R probably damaging Het
Tmem161b A G 13: 84,292,383 T125A probably benign Het
Trrap A G 5: 144,816,339 M1825V probably benign Het
Ttbk2 A G 2: 120,777,581 F186L probably damaging Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Zc3hc1 G C 6: 30,372,790 S351W probably damaging Het
Zfp366 T C 13: 99,234,251 M493T probably benign Het
Zfp93 C T 7: 24,275,861 P424S probably damaging Het
Other mutations in Zc3h7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Zc3h7a APN 16 11137338 missense probably damaging 0.98
IGL00908:Zc3h7a APN 16 11145242 missense probably damaging 0.99
IGL01087:Zc3h7a APN 16 11153182 missense probably benign 0.28
IGL01285:Zc3h7a APN 16 11139115 missense probably damaging 1.00
IGL01453:Zc3h7a APN 16 11149378 missense probably benign 0.00
IGL01639:Zc3h7a APN 16 11141708 missense possibly damaging 0.75
IGL01716:Zc3h7a APN 16 11145716 missense probably damaging 1.00
IGL02059:Zc3h7a APN 16 11160998 unclassified probably benign
IGL02170:Zc3h7a APN 16 11146395 missense probably benign
IGL02256:Zc3h7a APN 16 11147276 missense probably benign 0.04
IGL02904:Zc3h7a APN 16 11150666 missense probably damaging 1.00
IGL02941:Zc3h7a APN 16 11158594 critical splice acceptor site probably null
IGL03198:Zc3h7a APN 16 11162664 nonsense probably null
IGL03201:Zc3h7a APN 16 11156302 critical splice acceptor site probably null
IGL03302:Zc3h7a APN 16 11141710 missense probably damaging 1.00
Clement UTSW 16 11164602 nonsense probably null
R0062:Zc3h7a UTSW 16 11139147 missense probably damaging 1.00
R0255:Zc3h7a UTSW 16 11140737 missense probably damaging 1.00
R0545:Zc3h7a UTSW 16 11152333 unclassified probably benign
R0666:Zc3h7a UTSW 16 11156303 unclassified probably benign
R0831:Zc3h7a UTSW 16 11151880 missense probably damaging 0.99
R1127:Zc3h7a UTSW 16 11139075 missense probably damaging 1.00
R1296:Zc3h7a UTSW 16 11161026 missense probably damaging 1.00
R1472:Zc3h7a UTSW 16 11161026 missense probably damaging 1.00
R1499:Zc3h7a UTSW 16 11162656 missense probably damaging 1.00
R1747:Zc3h7a UTSW 16 11145253 missense possibly damaging 0.67
R1786:Zc3h7a UTSW 16 11150605 nonsense probably null
R1840:Zc3h7a UTSW 16 11161026 missense probably damaging 1.00
R1866:Zc3h7a UTSW 16 11147304 missense possibly damaging 0.81
R2055:Zc3h7a UTSW 16 11137476 missense probably benign 0.00
R2131:Zc3h7a UTSW 16 11150605 nonsense probably null
R2281:Zc3h7a UTSW 16 11158594 unclassified probably benign
R2399:Zc3h7a UTSW 16 11147401 missense probably damaging 1.00
R2979:Zc3h7a UTSW 16 11158973 missense probably damaging 1.00
R3915:Zc3h7a UTSW 16 11156210 missense possibly damaging 0.92
R4078:Zc3h7a UTSW 16 11151147 missense probably benign 0.05
R4095:Zc3h7a UTSW 16 11145235 missense probably damaging 1.00
R4208:Zc3h7a UTSW 16 11164644 missense possibly damaging 0.60
R4444:Zc3h7a UTSW 16 11150593 critical splice donor site probably null
R4739:Zc3h7a UTSW 16 11141709 missense probably damaging 1.00
R5059:Zc3h7a UTSW 16 11161121 frame shift probably null
R5545:Zc3h7a UTSW 16 11148451 missense possibly damaging 0.89
R5815:Zc3h7a UTSW 16 11156186 missense probably damaging 0.98
R5915:Zc3h7a UTSW 16 11164602 nonsense probably null
R5993:Zc3h7a UTSW 16 11150662 missense probably damaging 1.00
R6183:Zc3h7a UTSW 16 11147370 missense possibly damaging 0.81
R6459:Zc3h7a UTSW 16 11153161 missense probably damaging 1.00
R6513:Zc3h7a UTSW 16 11158765 critical splice acceptor site probably null
R6700:Zc3h7a UTSW 16 11158967 missense possibly damaging 0.59
R6904:Zc3h7a UTSW 16 11145671 missense probably damaging 1.00
R6964:Zc3h7a UTSW 16 11149224 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTCTGGGGCAGAATCAAGAAGAGC -3'
(R):5'- TCCCTCTGAAATATGCCTGCCAGC -3'

Sequencing Primer
(F):5'- GAGCATCTATTTCATCCCCAAGG -3'
(R):5'- GCAAGGCTGGATTGCATC -3'
Posted On2013-04-24