Incidental Mutation 'R3948:Hal'
ID307790
Institutional Source Beutler Lab
Gene Symbol Hal
Ensembl Gene ENSMUSG00000020017
Gene Namehistidine ammonia lyase
Synonymshistidase, Hsd
MMRRC Submission 040928-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R3948 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location93488768-93519304 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93489907 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 94 (I94T)
Ref Sequence ENSEMBL: ENSMUSP00000016031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016031] [ENSMUST00000129421]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016031
AA Change: I94T

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000016031
Gene: ENSMUSG00000020017
AA Change: I94T

DomainStartEndE-ValueType
low complexity region 60 71 N/A INTRINSIC
SCOP:d1gkma_ 114 161 6e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129421
AA Change: I94T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000123336
Gene: ENSMUSG00000020017
AA Change: I94T

DomainStartEndE-ValueType
Pfam:DUF3534 3 128 6e-9 PFAM
Pfam:Lyase_aromatic 116 590 1.3e-199 PFAM
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: This gene encodes a member of the histidase protein family. The encoded protein is a cytosolic enzyme which catalyzes the first reaction in histidine catabolism. Defects in this protein cause histidinemia, which is characterized by increased histidine in blood, urine, and cerebrospinal fluid. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mutations in this gene cause elevated histidine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat1 A G 4: 49,447,477 L368P possibly damaging Het
Adgrg4 C T X: 56,917,754 T1561I probably benign Het
Ankrd50 A G 3: 38,482,841 L121S possibly damaging Het
Arfgef1 CAGAG CAG 1: 10,142,586 probably null Het
Avil A G 10: 127,014,205 S642G probably benign Het
Avl9 T C 6: 56,728,665 probably null Het
BC003331 A T 1: 150,388,557 L67* probably null Het
Dhx15 T C 5: 52,161,580 probably benign Het
Disc1 A G 8: 125,088,135 E246G probably damaging Het
Dyrk4 A G 6: 126,885,305 I408T probably damaging Het
Fbxo38 A G 18: 62,529,544 probably benign Het
Gm13128 A C 4: 144,331,306 Q161P probably benign Het
H2-T24 T C 17: 36,017,372 Y73C probably damaging Het
Iqsec3 A T 6: 121,387,824 Y835* probably null Het
Irak3 T A 10: 120,170,373 M213L probably benign Het
Kcnj2 A G 11: 111,072,655 D291G possibly damaging Het
Krtap13 A G 16: 88,751,069 L177P possibly damaging Het
Mios A G 6: 8,215,496 T231A probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1228 A G 2: 89,248,992 F234S possibly damaging Het
Ralgapa1 C A 12: 55,698,767 V1268F probably damaging Het
Rev1 A T 1: 38,074,333 M551K possibly damaging Het
Serpinb9c A C 13: 33,150,094 C322G probably benign Het
Slc28a3 C T 13: 58,563,010 probably null Het
Slc35e4 A T 11: 3,912,970 V73E probably damaging Het
Ssh2 A G 11: 77,398,256 D88G probably damaging Het
Trim5 G A 7: 104,266,520 Q273* probably null Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vps13d G A 4: 145,141,340 T1974M probably damaging Het
Wdr25 T A 12: 109,027,282 C475S probably benign Het
Zfp202 C A 9: 40,208,425 H175N probably benign Het
Zfp248 TTAAATTCAT TT 6: 118,430,194 probably null Het
Other mutations in Hal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Hal APN 10 93490069 critical splice donor site probably null
IGL01528:Hal APN 10 93497593 missense probably damaging 1.00
IGL01818:Hal APN 10 93490984 missense probably damaging 0.99
IGL01903:Hal APN 10 93500607 splice site probably benign
IGL02152:Hal APN 10 93503542 missense possibly damaging 0.74
IGL02249:Hal APN 10 93497538 missense probably damaging 0.99
IGL02366:Hal APN 10 93503528 missense probably damaging 1.00
IGL02421:Hal APN 10 93503473 missense probably damaging 0.98
IGL02721:Hal APN 10 93507498 nonsense probably null
2k1 UTSW 10 93514143 critical splice donor site probably null
alger UTSW 10 93507551 critical splice donor site probably null
Whittaker UTSW 10 93516284 missense probably benign
R0048:Hal UTSW 10 93498991 missense probably damaging 1.00
R0238:Hal UTSW 10 93503482 missense possibly damaging 0.61
R0238:Hal UTSW 10 93503482 missense possibly damaging 0.61
R0239:Hal UTSW 10 93503482 missense possibly damaging 0.61
R0239:Hal UTSW 10 93503482 missense possibly damaging 0.61
R0372:Hal UTSW 10 93507553 splice site probably benign
R0465:Hal UTSW 10 93516284 missense probably benign
R0504:Hal UTSW 10 93489174 missense probably damaging 0.99
R1357:Hal UTSW 10 93500623 missense probably damaging 0.96
R1623:Hal UTSW 10 93516297 missense probably benign 0.00
R1757:Hal UTSW 10 93494628 missense probably benign 0.14
R1918:Hal UTSW 10 93496607 missense probably damaging 1.00
R2048:Hal UTSW 10 93491140 missense probably damaging 0.98
R2291:Hal UTSW 10 93503536 missense probably damaging 0.98
R3001:Hal UTSW 10 93507519 missense probably damaging 1.00
R3002:Hal UTSW 10 93507519 missense probably damaging 1.00
R3927:Hal UTSW 10 93514026 splice site probably benign
R4394:Hal UTSW 10 93496559 intron probably benign
R4623:Hal UTSW 10 93507439 missense probably damaging 1.00
R4922:Hal UTSW 10 93503539 missense probably damaging 1.00
R5018:Hal UTSW 10 93507551 critical splice donor site probably null
R5072:Hal UTSW 10 93514042 missense probably damaging 0.99
R5073:Hal UTSW 10 93514042 missense probably damaging 0.99
R5074:Hal UTSW 10 93514042 missense probably damaging 0.99
R5303:Hal UTSW 10 93516365 utr 3 prime probably benign
R5806:Hal UTSW 10 93490984 missense probably damaging 0.97
R5992:Hal UTSW 10 93490916 missense probably damaging 1.00
R6294:Hal UTSW 10 93514143 critical splice donor site probably null
R6370:Hal UTSW 10 93497506 missense probably damaging 1.00
R6747:Hal UTSW 10 93500677 missense probably damaging 1.00
R7142:Hal UTSW 10 93500651 missense possibly damaging 0.85
R7299:Hal UTSW 10 93492561 missense probably benign 0.00
R7301:Hal UTSW 10 93492561 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGACGCTAAGACCGTGTG -3'
(R):5'- GGCATATTTCAGACATGACAGAG -3'

Sequencing Primer
(F):5'- CCGTGTGAAAATGTAGGATGTCAC -3'
(R):5'- CATGACAGAGTTTTATATTCCCCAC -3'
Posted On2015-04-17