Mutagenetix > Incidental Mutation

Incidental Mutation 'R3948:Ssh2'

307795

Institutional Source

Beutler Lab

Gene Symbol

Ssh2

Ensembl Gene

ENSMUSG00000037926

Gene Name

slingshot protein phosphatase 2

Synonyms

SSH-2

MMRRC Submission

040928-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.241) question?

Stock #

R3948 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

77107113-77351046 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 77289082 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 88 (D88G)

Ref Sequence

ENSEMBL: ENSMUSP00000042625 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037912] [ENSMUST00000181283]

AlphaFold

Q5SW75

Predicted Effect

probably damaging
Transcript: ENSMUST00000037912
AA Change: D88G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000042625
Gene: ENSMUSG00000037926
AA Change: D88G

Domain	Start	End	E-Value	Type
low complexity region	9	18	N/A	INTRINSIC
Pfam:DEK_C	251	302	3.1e-13	PFAM
DSPc	307	445	2.2e-41	SMART
low complexity region	459	469	N/A	INTRINSIC
low complexity region	871	882	N/A	INTRINSIC
low complexity region	1002	1014	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127890

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180545

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180554

Predicted Effect

probably damaging
Transcript: ENSMUST00000181283
AA Change: D95G

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000137933
Gene: ENSMUSG00000037926
AA Change: D95G

Domain	Start	End	E-Value	Type
Pfam:DEK_C	256	309	1.7e-18	PFAM
DSPc	313	451	2.2e-41	SMART
low complexity region	465	475	N/A	INTRINSIC
low complexity region	877	888	N/A	INTRINSIC
low complexity region	1008	1020	N/A	INTRINSIC
low complexity region	1376	1391	N/A	INTRINSIC

Meta Mutation Damage Score

0.8839

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

100% (35/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein tyrosine phosphatase that plays a key role in the regulation of actin filaments. The encoded protein dephosphorylates and activates cofilin, which promotes actin filament depolymerization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acnat1	A	G	4: 49,447,477 (GRCm39)	L368P	possibly damaging	Het
Adgrg4	C	T	X: 55,963,114 (GRCm39)	T1561I	probably benign	Het
Ankrd50	A	G	3: 38,536,990 (GRCm39)	L121S	possibly damaging	Het
Arfgef1	CAGAG	CAG	1: 10,212,811 (GRCm39)		probably null	Het
Avil	A	G	10: 126,850,074 (GRCm39)	S642G	probably benign	Het
Avl9	T	C	6: 56,705,650 (GRCm39)		probably null	Het
Dhx15	T	C	5: 52,318,922 (GRCm39)		probably benign	Het
Disc1	A	G	8: 125,814,874 (GRCm39)	E246G	probably damaging	Het
Dyrk4	A	G	6: 126,862,268 (GRCm39)	I408T	probably damaging	Het
Fbxo38	A	G	18: 62,662,615 (GRCm39)		probably benign	Het
H2-T24	T	C	17: 36,328,264 (GRCm39)	Y73C	probably damaging	Het
Hal	T	C	10: 93,325,769 (GRCm39)	I94T	possibly damaging	Het
Iqsec3	A	T	6: 121,364,783 (GRCm39)	Y835*	probably null	Het
Irak3	T	A	10: 120,006,278 (GRCm39)	M213L	probably benign	Het
Kcnj2	A	G	11: 110,963,481 (GRCm39)	D291G	possibly damaging	Het
Krtap13	A	G	16: 88,547,957 (GRCm39)	L177P	possibly damaging	Het
Mios	A	G	6: 8,215,496 (GRCm39)	T231A	probably benign	Het
Obscn	T	C	11: 59,022,472 (GRCm39)	R758G	possibly damaging	Het
Odr4	A	T	1: 150,264,308 (GRCm39)	L67*	probably null	Het
Or4c122	A	G	2: 89,079,336 (GRCm39)	F234S	possibly damaging	Het
Pramel30	A	C	4: 144,057,876 (GRCm39)	Q161P	probably benign	Het
Ralgapa1	C	A	12: 55,745,552 (GRCm39)	V1268F	probably damaging	Het
Rev1	A	T	1: 38,113,414 (GRCm39)	M551K	possibly damaging	Het
Serpinb9c	A	C	13: 33,334,077 (GRCm39)	C322G	probably benign	Het
Slc28a3	C	T	13: 58,710,824 (GRCm39)		probably null	Het
Slc35e4	A	T	11: 3,862,970 (GRCm39)	V73E	probably damaging	Het
Trim5	G	A	7: 103,915,727 (GRCm39)	Q273*	probably null	Het
Ttn	T	A	2: 76,585,168 (GRCm39)	I22042F	probably damaging	Het
Vps13d	G	A	4: 144,867,910 (GRCm39)	T1974M	probably damaging	Het
Wdr25	T	A	12: 108,993,208 (GRCm39)	C475S	probably benign	Het
Zfp202	C	A	9: 40,119,721 (GRCm39)	H175N	probably benign	Het
Zfp248	TTAAATTCAT	TT	6: 118,407,155 (GRCm39)		probably null	Het

Other mutations in Ssh2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00811:Ssh2	APN	11	77,332,752 (GRCm39)	missense	probably damaging	1.00
IGL01141:Ssh2	APN	11	77,340,552 (GRCm39)	missense	probably damaging	1.00
IGL01520:Ssh2	APN	11	77,340,732 (GRCm39)	missense	probably damaging	1.00
IGL01803:Ssh2	APN	11	77,316,156 (GRCm39)	missense	probably damaging	0.99
IGL01989:Ssh2	APN	11	77,344,511 (GRCm39)	missense	possibly damaging	0.79
IGL02322:Ssh2	APN	11	77,307,239 (GRCm39)	critical splice acceptor site	probably null
IGL02466:Ssh2	APN	11	77,307,233 (GRCm39)	splice site	probably benign
IGL02683:Ssh2	APN	11	77,289,082 (GRCm39)	missense	probably damaging	0.99
IGL02706:Ssh2	APN	11	77,344,232 (GRCm39)	missense	possibly damaging	0.68
IGL02719:Ssh2	APN	11	77,316,413 (GRCm39)	missense	probably damaging	1.00
IGL02721:Ssh2	APN	11	77,345,551 (GRCm39)	nonsense	probably null
IGL02732:Ssh2	APN	11	77,328,602 (GRCm39)	splice site	probably null
IGL02745:Ssh2	APN	11	77,346,233 (GRCm39)	missense	probably damaging	1.00
IGL02993:Ssh2	APN	11	77,344,370 (GRCm39)	missense	probably damaging	1.00
IGL03000:Ssh2	APN	11	77,312,032 (GRCm39)	splice site	probably benign
david	UTSW	11	77,316,419 (GRCm39)	missense	probably damaging	1.00
faba	UTSW	11	77,332,811 (GRCm39)	missense	probably damaging	1.00
goliath	UTSW	11	77,344,349 (GRCm39)	missense	possibly damaging	0.48
Vicia	UTSW	11	77,345,792 (GRCm39)	missense	possibly damaging	0.68
IGL03055:Ssh2	UTSW	11	77,299,021 (GRCm39)	nonsense	probably null
R0024:Ssh2	UTSW	11	77,345,792 (GRCm39)	missense	possibly damaging	0.68
R0374:Ssh2	UTSW	11	77,298,969 (GRCm39)	missense	probably damaging	1.00
R0539:Ssh2	UTSW	11	77,345,620 (GRCm39)	missense	probably benign	0.11
R0834:Ssh2	UTSW	11	77,328,459 (GRCm39)	missense	possibly damaging	0.87
R1714:Ssh2	UTSW	11	77,344,850 (GRCm39)	missense	possibly damaging	0.94
R1743:Ssh2	UTSW	11	77,328,582 (GRCm39)	missense	probably damaging	1.00
R1889:Ssh2	UTSW	11	77,340,571 (GRCm39)	missense	probably damaging	1.00
R1895:Ssh2	UTSW	11	77,340,571 (GRCm39)	missense	probably damaging	1.00
R3945:Ssh2	UTSW	11	77,345,494 (GRCm39)	missense	possibly damaging	0.93
R3947:Ssh2	UTSW	11	77,289,082 (GRCm39)	missense	probably damaging	0.99
R4133:Ssh2	UTSW	11	77,312,095 (GRCm39)	missense	probably damaging	1.00
R4256:Ssh2	UTSW	11	77,299,009 (GRCm39)	missense	possibly damaging	0.48
R4499:Ssh2	UTSW	11	77,283,893 (GRCm39)	nonsense	probably null
R4548:Ssh2	UTSW	11	77,341,010 (GRCm39)	missense	probably benign	0.20
R4644:Ssh2	UTSW	11	77,340,402 (GRCm39)	missense	possibly damaging	0.46
R4690:Ssh2	UTSW	11	77,346,031 (GRCm39)	missense	possibly damaging	0.62
R4788:Ssh2	UTSW	11	77,320,624 (GRCm39)	missense	probably damaging	1.00
R4919:Ssh2	UTSW	11	77,316,146 (GRCm39)	missense	possibly damaging	0.91
R5014:Ssh2	UTSW	11	77,346,102 (GRCm39)	nonsense	probably null
R5380:Ssh2	UTSW	11	77,344,771 (GRCm39)	missense	probably benign	0.01
R5574:Ssh2	UTSW	11	77,340,941 (GRCm39)	missense	probably benign
R5593:Ssh2	UTSW	11	77,312,192 (GRCm39)	missense	probably damaging	0.99
R5739:Ssh2	UTSW	11	77,340,639 (GRCm39)	missense	probably damaging	1.00
R6180:Ssh2	UTSW	11	77,344,291 (GRCm39)	missense	probably benign	0.43
R6542:Ssh2	UTSW	11	77,340,976 (GRCm39)	missense	possibly damaging	0.94
R6713:Ssh2	UTSW	11	77,340,259 (GRCm39)	missense	possibly damaging	0.89
R7108:Ssh2	UTSW	11	77,345,620 (GRCm39)	missense	probably benign
R7124:Ssh2	UTSW	11	77,345,164 (GRCm39)	missense	probably benign	0.00
R7255:Ssh2	UTSW	11	77,316,419 (GRCm39)	missense	probably damaging	1.00
R7332:Ssh2	UTSW	11	77,344,349 (GRCm39)	missense	possibly damaging	0.48
R7362:Ssh2	UTSW	11	77,340,476 (GRCm39)	missense	probably benign	0.01
R7395:Ssh2	UTSW	11	77,283,899 (GRCm39)	missense	probably damaging	0.99
R7412:Ssh2	UTSW	11	77,340,934 (GRCm39)	missense	probably damaging	0.98
R7493:Ssh2	UTSW	11	77,328,542 (GRCm39)	missense	probably benign	0.16
R7686:Ssh2	UTSW	11	77,316,150 (GRCm39)	missense	possibly damaging	0.89
R7870:Ssh2	UTSW	11	77,344,441 (GRCm39)	missense	probably benign
R7895:Ssh2	UTSW	11	77,345,452 (GRCm39)	missense	probably benign	0.41
R7963:Ssh2	UTSW	11	77,312,182 (GRCm39)	missense	possibly damaging	0.93
R8030:Ssh2	UTSW	11	77,345,332 (GRCm39)	missense	probably benign	0.01
R8065:Ssh2	UTSW	11	77,332,811 (GRCm39)	missense	probably damaging	1.00
R8099:Ssh2	UTSW	11	77,345,755 (GRCm39)	nonsense	probably null
R8294:Ssh2	UTSW	11	77,345,027 (GRCm39)	missense	probably benign	0.08
R8464:Ssh2	UTSW	11	77,345,079 (GRCm39)	nonsense	probably null
R8469:Ssh2	UTSW	11	77,340,434 (GRCm39)	missense	probably benign	0.41
R8547:Ssh2	UTSW	11	77,340,533 (GRCm39)	missense	probably benign	0.10
R8677:Ssh2	UTSW	11	77,346,019 (GRCm39)	missense	possibly damaging	0.77
R8758:Ssh2	UTSW	11	77,344,843 (GRCm39)	missense	probably benign
R9029:Ssh2	UTSW	11	77,328,454 (GRCm39)	missense	probably damaging	1.00
R9030:Ssh2	UTSW	11	77,312,062 (GRCm39)	missense	possibly damaging	0.63
R9126:Ssh2	UTSW	11	77,346,102 (GRCm39)	nonsense	probably null
R9146:Ssh2	UTSW	11	77,328,502 (GRCm39)	missense	probably damaging	0.98
R9377:Ssh2	UTSW	11	77,298,974 (GRCm39)	missense	possibly damaging	0.95
R9483:Ssh2	UTSW	11	77,283,976 (GRCm39)	missense	possibly damaging	0.81
R9615:Ssh2	UTSW	11	77,316,203 (GRCm39)	missense	possibly damaging	0.48
RF018:Ssh2	UTSW	11	77,344,880 (GRCm39)	missense	probably damaging	0.99
X0017:Ssh2	UTSW	11	77,332,724 (GRCm39)	missense	probably damaging	1.00
Z1088:Ssh2	UTSW	11	77,340,321 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATGATACATGAGCAAGTGTGCAC -3'
(R):5'- CTTCTCCAACTAGGACAAAGTTCC -3'

Sequencing Primer
(F):5'- gtgcactcacaGTGAAATA -3'
(R):5'- TGGAGAATAATTTACAAACCAGCTC -3'

Posted On

2015-04-17