Incidental Mutation 'R3949:Disc1'
ID307825
Institutional Source Beutler Lab
Gene Symbol Disc1
Ensembl Gene ENSMUSG00000043051
Gene Namedisrupted in schizophrenia 1
Synonyms
MMRRC Submission 040929-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.662) question?
Stock #R3949 (G1)
Quality Score175
Status Validated
Chromosome8
Chromosomal Location125054195-125261858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125088135 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 246 (E246G)
Ref Sequence ENSEMBL: ENSMUSP00000074147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074562] [ENSMUST00000075730] [ENSMUST00000098311] [ENSMUST00000115885] [ENSMUST00000117658] [ENSMUST00000118942] [ENSMUST00000121953] [ENSMUST00000122389]
Predicted Effect probably damaging
Transcript: ENSMUST00000074562
AA Change: E246G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074147
Gene: ENSMUSG00000043051
AA Change: E246G

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075730
AA Change: E246G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000075145
Gene: ENSMUSG00000043051
AA Change: E246G

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098311
AA Change: E246G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000095914
Gene: ENSMUSG00000043051
AA Change: E246G

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115885
AA Change: E246G

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111552
Gene: ENSMUSG00000043051
AA Change: E246G

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117658
AA Change: E246G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112757
Gene: ENSMUSG00000043051
AA Change: E246G

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118942
AA Change: E246G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112410
Gene: ENSMUSG00000043051
AA Change: E246G

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121953
AA Change: E244G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112929
Gene: ENSMUSG00000043051
AA Change: E244G

DomainStartEndE-ValueType
low complexity region 218 228 N/A INTRINSIC
low complexity region 286 322 N/A INTRINSIC
coiled coil region 370 395 N/A INTRINSIC
coiled coil region 447 494 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
low complexity region 622 634 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122389
AA Change: E246G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112593
Gene: ENSMUSG00000043051
AA Change: E246G

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126111
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple coiled coil motifs which is located in the nucleus, cytoplasm and mitochondria. The protein is involved in neurite outgrowth and cortical development through its interaction with other proteins. This gene is disrupted in a t(1;11)(q42.1;q14.3) translocation which segregates with schizophrenia and related psychiatric disorders in a large Scottish family. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show altered anxiety, synaptic depression, LTP, impulsivity, social investigation, hyperactivity and prepulse inhibition. Homozygotes for a spontaneous allele show altered working memory. Different ENU mutations cause distinct depression and schizophrenia-like profiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 A T 13: 8,570,419 M314L probably damaging Het
Apcs A G 1: 172,894,692 F29S probably damaging Het
Arfgef1 CAGAG CAG 1: 10,142,586 probably null Het
Avl9 T C 6: 56,728,665 probably null Het
Ccdc130 A G 8: 84,258,824 V272A probably benign Het
Ccdc38 A G 10: 93,550,219 M66V probably damaging Het
Cfap46 T C 7: 139,678,551 K269E probably benign Het
Chrdl2 A C 7: 100,029,205 E328A possibly damaging Het
D430041D05Rik T C 2: 104,257,368 N421S probably benign Het
Dbndd1 G T 8: 123,506,734 Q207K probably benign Het
Dyrk4 A G 6: 126,885,305 I408T probably damaging Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Fan1 C A 7: 64,371,544 E591* probably null Het
Fpr1 C A 17: 17,876,929 C266F probably benign Het
Gata4 C T 14: 63,240,697 R151H possibly damaging Het
Gipr T C 7: 19,157,429 N441S probably benign Het
Ino80d G T 1: 63,074,503 Q263K probably benign Het
Ipo13 A G 4: 117,901,042 I708T probably benign Het
Iqsec3 A T 6: 121,387,824 Y835* probably null Het
Kctd8 C T 5: 69,341,274 G10S probably benign Het
Lamb1 A C 12: 31,282,649 K257Q probably damaging Het
Lcp1 A G 14: 75,206,129 N195S possibly damaging Het
Olfr1298 A T 2: 111,645,526 I157K possibly damaging Het
Olfr1480 T C 19: 13,530,020 S160P probably damaging Het
Paxbp1 T C 16: 91,044,017 D113G probably damaging Het
Pcdhb7 T C 18: 37,343,088 S426P probably benign Het
Pcnx4 A G 12: 72,556,302 D446G probably benign Het
Pkd1 T A 17: 24,578,037 probably benign Het
Pld2 A G 11: 70,553,354 D492G probably benign Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rasgrf1 A C 9: 89,981,744 probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Serpinb10 T A 1: 107,540,906 L170H probably damaging Het
Sfxn4 A G 19: 60,852,063 Y165H probably damaging Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Slco5a1 A T 1: 12,989,609 V296D probably damaging Het
Syn2 T A 6: 115,227,329 probably null Het
Tbx2 C T 11: 85,838,275 Q495* probably null Het
Trav6-1 G A 14: 52,638,536 V8M probably benign Het
Usp7 A T 16: 8,716,564 N46K probably damaging Het
Vmn2r58 A T 7: 41,863,924 F432I probably benign Het
Vmn2r99 T C 17: 19,378,990 M312T probably benign Het
Washc2 T C 6: 116,208,204 probably benign Het
Other mutations in Disc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Disc1 APN 8 125088275 missense probably benign 0.27
IGL01319:Disc1 APN 8 125087891 missense probably damaging 0.99
IGL02001:Disc1 APN 8 125251042 missense probably damaging 0.97
IGL02403:Disc1 APN 8 125135519 splice site probably benign
IGL02445:Disc1 APN 8 125148403 splice site probably benign
R0334:Disc1 UTSW 8 125261097 synonymous probably null
R0992:Disc1 UTSW 8 125088042 missense probably damaging 1.00
R1654:Disc1 UTSW 8 125148465 missense possibly damaging 0.90
R1711:Disc1 UTSW 8 125124610 missense probably benign 0.05
R3154:Disc1 UTSW 8 125135304 missense probably damaging 1.00
R3947:Disc1 UTSW 8 125088135 missense probably damaging 1.00
R3948:Disc1 UTSW 8 125088135 missense probably damaging 1.00
R4051:Disc1 UTSW 8 125148425 missense possibly damaging 0.85
R4199:Disc1 UTSW 8 125148459 missense probably damaging 1.00
R4691:Disc1 UTSW 8 125148447 missense possibly damaging 0.90
R4763:Disc1 UTSW 8 125124538 missense probably damaging 1.00
R4825:Disc1 UTSW 8 125135302 missense possibly damaging 0.86
R4969:Disc1 UTSW 8 125124550 nonsense probably null
R5087:Disc1 UTSW 8 125132160 missense probably benign
R5383:Disc1 UTSW 8 125135457 missense probably damaging 1.00
R5827:Disc1 UTSW 8 125135365 missense probably damaging 1.00
R5828:Disc1 UTSW 8 125251024 missense probably damaging 0.99
R6431:Disc1 UTSW 8 125135389 missense possibly damaging 0.87
R6501:Disc1 UTSW 8 125218105 missense probably benign 0.00
R6794:Disc1 UTSW 8 125087775 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- CAGACAGCTTTAAGTCTCTGGC -3'
(R):5'- TGCATCCTGGGAAGAGAAGC -3'

Sequencing Primer
(F):5'- TGAAGACTGTGAAACCTCTGGCATC -3'
(R):5'- CCTGGGAAGAGAAGCCAGTGTC -3'
Posted On2015-04-17