Incidental Mutation 'R3949:Vmn2r99'
ID307839
Institutional Source Beutler Lab
Gene Symbol Vmn2r99
Ensembl Gene ENSMUSG00000090304
Gene Namevomeronasal 2, receptor 99
SynonymsEG665376
MMRRC Submission 040929-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R3949 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location19361949-19401098 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19378990 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 312 (M312T)
Ref Sequence ENSEMBL: ENSMUSP00000156067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176107] [ENSMUST00000231989]
Predicted Effect probably benign
Transcript: ENSMUST00000176107
AA Change: M312T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135236
Gene: ENSMUSG00000090304
AA Change: M312T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 81 448 5.7e-33 PFAM
Pfam:NCD3G 508 561 1.8e-21 PFAM
Pfam:7tm_3 593 829 4.6e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231989
AA Change: M312T

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
Meta Mutation Damage Score 0.1272 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 A T 13: 8,570,419 M314L probably damaging Het
Apcs A G 1: 172,894,692 F29S probably damaging Het
Arfgef1 CAGAG CAG 1: 10,142,586 probably null Het
Avl9 T C 6: 56,728,665 probably null Het
Ccdc130 A G 8: 84,258,824 V272A probably benign Het
Ccdc38 A G 10: 93,550,219 M66V probably damaging Het
Cfap46 T C 7: 139,678,551 K269E probably benign Het
Chrdl2 A C 7: 100,029,205 E328A possibly damaging Het
D430041D05Rik T C 2: 104,257,368 N421S probably benign Het
Dbndd1 G T 8: 123,506,734 Q207K probably benign Het
Disc1 A G 8: 125,088,135 E246G probably damaging Het
Dyrk4 A G 6: 126,885,305 I408T probably damaging Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Fan1 C A 7: 64,371,544 E591* probably null Het
Fpr1 C A 17: 17,876,929 C266F probably benign Het
Gata4 C T 14: 63,240,697 R151H possibly damaging Het
Gipr T C 7: 19,157,429 N441S probably benign Het
Ino80d G T 1: 63,074,503 Q263K probably benign Het
Ipo13 A G 4: 117,901,042 I708T probably benign Het
Iqsec3 A T 6: 121,387,824 Y835* probably null Het
Kctd8 C T 5: 69,341,274 G10S probably benign Het
Lamb1 A C 12: 31,282,649 K257Q probably damaging Het
Lcp1 A G 14: 75,206,129 N195S possibly damaging Het
Olfr1298 A T 2: 111,645,526 I157K possibly damaging Het
Olfr1480 T C 19: 13,530,020 S160P probably damaging Het
Paxbp1 T C 16: 91,044,017 D113G probably damaging Het
Pcdhb7 T C 18: 37,343,088 S426P probably benign Het
Pcnx4 A G 12: 72,556,302 D446G probably benign Het
Pkd1 T A 17: 24,578,037 probably benign Het
Pld2 A G 11: 70,553,354 D492G probably benign Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rasgrf1 A C 9: 89,981,744 probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Serpinb10 T A 1: 107,540,906 L170H probably damaging Het
Sfxn4 A G 19: 60,852,063 Y165H probably damaging Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Slco5a1 A T 1: 12,989,609 V296D probably damaging Het
Syn2 T A 6: 115,227,329 probably null Het
Tbx2 C T 11: 85,838,275 Q495* probably null Het
Trav6-1 G A 14: 52,638,536 V8M probably benign Het
Usp7 A T 16: 8,716,564 N46K probably damaging Het
Vmn2r58 A T 7: 41,863,924 F432I probably benign Het
Washc2 T C 6: 116,208,204 probably benign Het
Other mutations in Vmn2r99
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Vmn2r99 APN 17 19378854 missense probably benign 0.01
IGL01113:Vmn2r99 APN 17 19394256 missense probably benign 0.20
IGL01138:Vmn2r99 APN 17 19382623 missense probably damaging 0.97
IGL01646:Vmn2r99 APN 17 19393658 splice site probably benign
IGL01769:Vmn2r99 APN 17 19380115 missense probably damaging 1.00
IGL02112:Vmn2r99 APN 17 19380232 missense probably null 0.99
IGL02891:Vmn2r99 APN 17 19378690 nonsense probably null
IGL03132:Vmn2r99 APN 17 19378223 nonsense probably null
FR4548:Vmn2r99 UTSW 17 19394285 missense probably damaging 0.97
FR4976:Vmn2r99 UTSW 17 19394285 missense probably damaging 0.97
PIT4382001:Vmn2r99 UTSW 17 19394343 missense probably damaging 1.00
R0196:Vmn2r99 UTSW 17 19394573 missense probably benign 0.00
R0720:Vmn2r99 UTSW 17 19379043 missense probably benign 0.00
R1501:Vmn2r99 UTSW 17 19362259 missense possibly damaging 0.93
R1519:Vmn2r99 UTSW 17 19380060 missense probably benign 0.00
R1670:Vmn2r99 UTSW 17 19362252 missense probably benign 0.37
R1682:Vmn2r99 UTSW 17 19377945 missense probably damaging 0.97
R1873:Vmn2r99 UTSW 17 19362153 missense probably benign 0.25
R1967:Vmn2r99 UTSW 17 19378815 missense probably benign 0.01
R2101:Vmn2r99 UTSW 17 19377991 missense probably damaging 1.00
R2474:Vmn2r99 UTSW 17 19378629 missense probably benign 0.04
R2519:Vmn2r99 UTSW 17 19378708 missense probably damaging 0.99
R3911:Vmn2r99 UTSW 17 19394373 missense possibly damaging 0.92
R3947:Vmn2r99 UTSW 17 19378990 missense probably benign 0.40
R4016:Vmn2r99 UTSW 17 19378570 missense possibly damaging 0.86
R4413:Vmn2r99 UTSW 17 19379260 missense probably damaging 1.00
R4594:Vmn2r99 UTSW 17 19393662 missense probably damaging 1.00
R4999:Vmn2r99 UTSW 17 19362135 start codon destroyed probably null 0.96
R5206:Vmn2r99 UTSW 17 19378606 missense probably benign 0.40
R5362:Vmn2r99 UTSW 17 19379339 missense probably benign 0.00
R5377:Vmn2r99 UTSW 17 19379269 missense probably damaging 1.00
R5455:Vmn2r99 UTSW 17 19394146 nonsense probably null
R6021:Vmn2r99 UTSW 17 19377948 missense probably damaging 1.00
R6059:Vmn2r99 UTSW 17 19378980 missense probably benign 0.00
R6214:Vmn2r99 UTSW 17 19382558 missense probably benign 0.19
R6215:Vmn2r99 UTSW 17 19382558 missense probably benign 0.19
R6313:Vmn2r99 UTSW 17 19382605 missense probably damaging 1.00
R6646:Vmn2r99 UTSW 17 19380031 missense probably damaging 1.00
R6810:Vmn2r99 UTSW 17 19380034 missense probably benign 0.20
R6885:Vmn2r99 UTSW 17 19380195 missense possibly damaging 0.52
R6991:Vmn2r99 UTSW 17 19378110 missense probably benign 0.03
R7060:Vmn2r99 UTSW 17 19394564 nonsense probably null
R7090:Vmn2r99 UTSW 17 19393710 missense possibly damaging 0.83
R7094:Vmn2r99 UTSW 17 19379311 missense probably benign 0.00
R7449:Vmn2r99 UTSW 17 19379145 missense probably benign 0.01
Z1088:Vmn2r99 UTSW 17 19379301 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GCCACATGGACTTCATATTTTGC -3'
(R):5'- ACCCATCAAATATGTGACGAGG -3'

Sequencing Primer
(F):5'- TGCCAAATTCTGGGAAAATATGG -3'
(R):5'- CATCCAAAGAAGCATTGGTTTGACAG -3'
Posted On2015-04-17